terça-feira, 8 de setembro de 2009

Nova arma contra a esquistossomose Pesquisa mapeia o genoma do parasita Schistossoma mansoni e abre frente para a criação de novos remédios e vacinas

Publicação: 08/09/2009 08:00 - Correio Braziliense


A esquistossomose faz parte de uma lista de doenças que, apesar de atingir milhares de pessoas em todo o mundo, nunca motivaram a indústria farmacêutica a investir no desenvolvimento de remédios ou vacinas para combatê-las. Isso porque esse e outros males — como a malária, a leishmaniose e o mal de Chagas — costumam afetar principalmente as populações de países pobres, que não trariam retorno financeiro aos laboratórios. Até pouco tempo atrás, apenas um remédio, produzido pelo laboratório Merck, era indicado para tratar o problema causado pelo parasita Schistossoma mansoni. No entanto, uma pesquisa, desenvolvida por cientistas de vários países, conseguiu mapear o genoma do parasita e indicar que outros medicamentos podem ser eficazes no tratamento da enfermidade.

 - ()
Dois cientistas brasileiros participaram do estudo com colegas dos Estados Unidos, Inglaterra, França, Alemanha, Irlanda e Japão. Essa colaboração conseguiu catalogar as proteínas do verme. O biólogo molecular do Instituto de Física de São Carlos, da Universidade de São Paulo (USP), Ricardo De Marco encontrou medicamentos que atuam contra proteínas encontradas no Schistossoma. “Como esses remédios são usados para outras doenças, eles já foram testados em humanos, em relação à toxidade e efeitos colaterais, não precisando ser testados em humanos nesses aspectos”, lembra. “Entretanto, essas drogas precisam ser estudadas em sua eficiência contra a doença.”

Guilherme Oliveira, também biólogo molecular, do Centro de Pesquisas René Rachou, da Fundação Oswaldo Cruz (Fiocruz) de Belo Horizonte, organizou proteínas diferentes e também chegou à mesma conclusão. Segundo ele, existem algumas drogas que já foram listadas e estão sendo testadas. “Temos 50 drogas que podem atuar contra 30 proteínas já identificadas”, revela. “Essa lista pode crescer, mas a ideia é identificar mais proteínas que possam ser utilizadas nas pesquisas.” Esses dois estudos usaram o sequenciamento genético do parasita e trabalharam com um número muito grande de informações, que permitiram o melhor entendimento do seu ciclo de vida. Com isso, foi possível identificar várias proteínas que podem ser usadas em diferentes formas de combater o parasita.

No Brasil, a doença é causada pelo Schistossoma mansoni, mas também existem os tipos japonicum (Ásia) e hematobium (África), que infectam seres humanos. De Marco estudou a origem do Schistossoma para verificar se o verme surgiu de uma evolução do parente asiático. Para ele, esse estudo vai auxiliar no entendimento do ciclo de vida do parasita. Ele também verificou o DNA do verme com a intenção de interromper sua adaptação ao corpo humano. Além de mapear as reações metabólicas, Oliveira estudou dois grupos de proteínas: as proteases, que filtram o sangue humano para o verme se alimentar, e as quinases, que são uma rede de sinais relacionados à reprodução. Para Oliveira, a intenção é matar o parasita de fome e perturbar a sua regulação.

A Organização Mundial de Saúde (OMS) estima que 200 milhões de pessoas estejam infectadas com esquistossomose no mundo todo. Acredita-se que a doença cause a morte de 20 mil indivíduos todos os anos. Algumas pesquisas para a criação de vacinas ainda não tiveram resultado positivo, mas De Marco acredita que o número de proteínas encontradas pode ser importante para o desenvolvimento de uma forma de imunização. “O bom desse resultado é que ele vai servir como um catalisador para novas pesquisas”, afirma. Oliveira também identificou uma série de proteínas encontradas na superfície do parasita e que pode ser testada como vacinas. Todos os resultados foram publicados e estão disponíveis para qualquer cientista que queira estudar o Schistossoma.

Na América do Sul
O Brasil é o principal foco da doença na América do Sul, com aproximadamente 41 mil casos confirmados no ano passado. Segundo dados do Programa Nacional de Controle da Esquistossomose do Ministério da Saúde, a taxa de mortalidade da doença reduziu, nas últimas três décadas, de 0,7% para 0,3% ao ano.

quarta-feira, 26 de agosto de 2009

Seis razões para tentar o parto normal


Texto extremamente elucidativo sobre a polêmica entre o parto normal e suas vantagens.


Bons estudos


Por Paula Desgualdo



Como a natureza quer: se o parto normal é o desfecho natural de uma gravidez, por que fugir dele antes mesmo de saber se uma cesárea é de fato indicada para o seu caso? “O ideal é que o bebê escolha o dia em que quer nascer”, diz o obstetra Luiz Fernando Leite, das maternidades Santa Joana e Pro Matre, em São Paulo. É claro que, na hora do parto, às vezes surgem complicações. Aí, sejamos justos, a cesariana pode até salvar a vida da mãe e do filho. “Mas, quando a cirurgia é agendada com muita antecedência, corre-se o risco de a criança nascer prematura, mais magra e com os músculos ainda não completamente desenvolvidos”, adverte o obstetra.

A criança respira melhor: quando passa pelo canal da vagina, o tórax do bebê é comprimido, assim como o resto do seu corpo. “Isso garante que o líquido amniótico de dentro dos seus pulmões seja expelido pela boca, facilitando o primeiro suspiro da criança na hora em que nasce”, explica Rosangela Garbers, neonatalogista do Hospital Pequeno Príncipe, em Curitiba. Sem falar que as contrações uterinas estressam o bebê – e isso está longe de ser ruim. O hormônio cortisol produzido pelo organismo infantil deixa os pulmões preparados para trabalhar a todo vapor. A cesárea, por sua vez, aumenta o risco de ocorrer o que os especialistas chamam de desconforto respiratório. Esse problema pode levar a quadros de insuficiência respiratória e até favorecer a pneumonia.


Acelera a descida do leite: “Durante o trabalho de parto, o organismo da mulher libera os hormônios ocitocina e prolactina, que facilitam a apojadura”, afirma Mariano Sales Junior, da maternidade Hilda Brandão, da Santa Casa de Belo Horizonte. No caso da cesárea eletiva, a mulher pode ser submetida à cirurgia sem o menor indício de que o bebê está pronto para nascer. Daí, o organismo talvez secrete as substâncias que deflagram a produção do leite com certo atraso – de dois a cinco dias depois do nascimento do bebê. Resumo da ópera: a criança terá de esperar para ser amamentada pela mãe.


Cai o mito da dor: por mais ultrapassada que seja, a imagem de uma mãe urrando na hora do parto não sai da cabeça de muitas mulheres. Segundo Washington Rios, coordenador da maternidade de alto risco do Hospital das Clínicas da Universidade Federal de Goiás, não há o que temer. “A analgesia é perfeitamente capaz de controlar a dor”, afirma. Isso porque há mais de dez anos os médicos recorrem a uma estratégia que combina a anestesia raquidiana, a mesma usada na cesárea, e a peridural. “A paciente não sofre, mas também não perde totalmente a sensibilidade na região pélvica”, explica a anestesista Wanda Carneiro, diretora clínica do Hospital e Maternidade São Luiz, em São Paulo. Dessa forma, ela consegue sentir as contrações e até ajudar a impulsionar a criança para fora.


Recuperação a jato: 48 horas após o parto normal, a nova mamãe pode ir para casa com o seu bebê. Em alguns casos, para facilitar a saída da criança, os médicos realizam a episiotomia, um pequeno corte lateral na região do períneo, área situada entre a vagina e o ânus. Quando isso acontece, a cicatrização geralmente leva uma semana. Já quem vai de cesariana recebe alta normalmente entre 60 e 72 horas após o parto e pode levar de 30 a 40 dias para se livrar das dores.


Mais segurança: como em qualquer cirurgia, a cesárea envolve riscos de infecção e até de morte da criança. “Cerca de 12% dos bebês que nascem de cesariana vão para a UTI”, revela Renato Kalil, obstetra do Hospital e Maternidade São Luiz, em São Paulo. No parto normal, esse número cai para 3%. “A sensação da cesariana é semelhante à de qualquer outra cirurgia no abdômen. É, enfim, como extrair uma porção do intestino ou operar o estômago”, compara Kalil. E, convenhamos, o clima de uma sala cirúrgica não é dos mais agradáveis: as máscaras dos médicos, a sedação, a dificuldade para se mexer...

quinta-feira, 28 de maio de 2009

Mais importante "de que curso vou fazer na universidade": um plano de carreira!

Todo o estudante de ensino médio, isso quando a pressão não começa no maternal; pergunta-se que curso irá fazer. Tão ou mais importante que a resposta a esta questão, é outra pergunta que não aflora em cabeças tão jovens mas que deve pertencer ao universo das novas gerações: como definir um plano de carreira! A pergunta começa a ser elucidada como uma técnica ateniense de perguntas realizadas para se chegar a resposta de outra pergunta. Neste caso:

* Onde quero estar profissionalmente (o que inclui trabalho, estudos, posição social, segurança capital, etc.) nos próximos: 5, 10, 15 e 20 anos
* O que devo realizar para atingir os objetivos da questão anterior?
* Quais são as necessidades do mercado empregador ou de empreendimentos em relação aos novos profissionais?
* O que minha concorrência esta fazendo e como posso proceder para tornar-me competitivo e potencialmente melhor ou equivalente aos selecionados no mercado?
* Como as pressões decorrentes das ações profissionais DEVEM se adequar as minhas preferências pessoais e personalidade?

Deixar para seu eu-futuro pensar sobre tais questões, certamente é diminuir um precioso tempo que poderia ser usado para melhorar suas potencialidades de sucesso.
Abaixo, um interessante texto de Luana Magalhães (da infoMoney). 

Abraços

Prof. Augusto César Willer

Veja como organizar seu plano de carreira desde o vestibular






"O que você quer ser quando crescer?" Certamente, quando criança você respondeu essa pergunta. Mas em questão de planejamento de carreira, o quanto antes você pensar, planejar e traçar metas, as possibilidades de sucesso serão maiores.

"Uma carreira não é feita de cargos que você ocupou na empresa, mas sim de habilidades e conhecimento, ou seja, o que eu fui capaz de resolver, que resultados eu apresentei, durante o tempo em que eu fui diretor de uma companhia?", ressalta a consultora da DBM, Irene Azevedo.

Faculdade

Ela afirma que a pessoa precisa planejar a sua carreira na época do vestibular. "Atualmente, as organizações são pressionadas por resultados. Assim, se você não fizer o que gosta, você não irá aguentar a pressão. Portanto, não interessa se aquele segmento é o que vai crescer, o importante é fazer o que gosta."

Depois de decidir o curso de graduação e ingressar em uma faculdade, Irene destaca que é hora de pensar em estágios.

Recém-formado

Após um ano de conclusão do ensino superior, a consultora alerta que é fundamental ter o conhecimento de línguas estrangeiras.

"Não adianta ter uma pós-graduação e não ter o inglês e o espanhol fluentes. Hoje, muitas empresas podem até não usar o inglês, mas cobram esse requisito nos seus processos de seleção, logo você pode perder uma boa oportunidade de emprego por não ter esse conhecimento".

Formado há cinco anos

Com cinco anos de formado, Irene afirma que é importante ter no currículo uma pós-graduação ou um mestrado.

"Se você pretende um dia atuar na área acadêmica, esse é o momento de pensar em desenvolver conhecimento teórico, investindo em um mestrado. Mas, se o mundo acadêmico não faz parte dos seus planos, invista em uma pós-graduação lato-sensu"

Com diploma há sete anos

Agora, se você já concluiu o ensino superior há sete anos e têm os conhecimentos teóricos acima, na opinião de Irene, chegou a vez de fazer um MBA ou um doutorado. "Se você quer atuar no ramo acadêmico, o doutorado é importante. Caso contrário, procure fazer um MBA".

domingo, 29 de março de 2009

Pra quem sempre sonhou com uma juventude em viagens...



Recebi no meu e-mail um relato de um blog de um estudante aqui de Brasília que formou-se em Relações internacionais... Não sei, tenho quase certeza de que foi meu aluno em épocas remotas. 

Neste blog ele conta suas aventuras de forma muito bem humorada em suas viagens ao redor do mundo... vale a pena e deixarei nos links desta página como referência... Valeu

segunda-feira, 12 de janeiro de 2009

Profissão: biólogo(a)

Um rápido vídeo que nos mostra algumas áreas de atuação direta da profissão de biólogo(a).







Grande abraço

Prof. Augusto César

quarta-feira, 20 de agosto de 2008

Exercícios complementares de Ecologia I

Exercícios complementares para o 1º ano do E.M: Ecologia I (conceitos básicos, cadeias/teias alimentares, pirâmides ecológicas, produtividade em ecossistemas e ciclos biogeoquímicos).


Parte I: Introdução à Ecologia

1) (PUC-SP) O conjunto do ambiente físico e dos organismos que nele vivem é conhecido como:

a) biótopo
b) ecossistema
c) biomassa
d) bioma
e) comunidade

2) (MOGI) Ao conjunto de indivíduos de diferentes espécies habitando determinada área dá-se o nome de:

a) ecossistema
b) comunidade
c) população
d) bioma
e) biosfera

3) Com relação aos conceitos de HABITAT e NICHO ECOLÓGICO, marque a opção correta relacionada abaixo:

a) cobra e gavião ocupam o mesmo habitat.
b) preá e cobra estão no mesmo nicho ecológico.
c) gavião, cobra e preá estão no mesmo nicho ecológico.
d) cobras neste mesmo local ocupam o mesmo nicho ecológico.
e) preás podem ocupar o mesmo habitat, mas têm nichos ecológicos diferentes.

4) O ambiente descrito, com inúmeros animais e vegetais, à beira de um charco de água doce que, durante o dia, sofre flutuações de temperatura, luminosidade, maior ou menor pH e até alterações de salinidade, poderá ser classificado como um exemplo de:

a) biosfera
b) biótipo
c) biomassa
d) ecótone
e) ecossistema

5) Suponha que em um terreno coberto de capim gordura vivem saúvas, gafanhotos, pardais, preás e ratos-do-campo. Nesta região estão presentes:

a) cinco populações.
b) seis populações.
c) duas comunidades.
d) seis comunidades.
e) dois ecossistemas.

6) Indivíduos de diversas espécies, que habitam determinada região, constituem:

a) um bioma.
b) uma sociedade.
c) uma população.
d) uma comunidade.
e) um ecossistema.

7) (UA-AM) A posição de uma espécie num ecossistema ao nível de desempenho funcional chama-se:

a) nicho ecológico d) produtividade primária
b) habitat preferencial e) territorialidade social
c) plasticidade ecológica

8) ( MED. SANTOS) Assinale a alternativa CORRETA:

a) Em Ecologia, a COMUNIDADE inclui grupos de indivíduos de uma mesma espécie de organismos.
b) Em Ecologia, a POPULAÇÃO inclui todos os indivíduos de uma mesma área, pertencentes ou não a várias espécies.
c) Em Ecologia, o ECOSSISTEMA é a porção da terra biologicamente habitada.
d) Em Ecologia, a BIOSFERA é o conjunto formado pela comunidade de indivíduos vivos e o meio ambiente inerente.
e) Nenhuma das anteriores.

9) (CESCEM) São ecossistemas todos os exemplos abaixo, EXCETO:

a) uma astronave.
b) uma lagoa.
c) um pasto.
d) uma colônia de corais.
e) o solo.

10) (MED. ABC) Suponha duas plantas pertencentes ao mesmo gênero e vivendo juntas na mesma área. A espécie A tem raízes que se desenvolvem logo abaixo da superfície e a espécie B tem raízes profundas. Sobre as duas plantas fazemos as seguintes afirmações:

I - A e B vivem no mesmo nicho ecológico.
II - A e B competem pela água.
III - A e B formam uma população.

Assinale:

a) Apenas I é correta.
b) Apenas II é correta.
c) Apenas III é correta.
d) I, II e III são corretas.
e) Nenhuma é correta.

11) (UERJ) Mergulhando em águas costeiras, encontramos em uma rocha algas, cracas, anêmonas, estrelas-do-mar e ouriços-do-mar. As algas produzem seu próprio alimento. As cracas ingerem, com água, seres microscópios que nela vivem. As anêmonas comem pequenos peixes que ficam presos entre seus tentáculos. As estrelas-do-mar prendem seus “braços” os moluscos contra a rocha e sugam o animal de dentro da rocha. Os ouriços do mar raspam a rocha com seus “dentes”, alimentando-se de detritos. Em função do que foi descrito, pode-se afirmar que as algas e os animais citados apresentam diferentes

a) nichos.
b) habitats.
c) mimetismos.
d) competições.
e) biomas.

12) (SANTA CASA) Os animais marinhos:
-que flutuam e são movidos passivamente pelos ventos, ondas e correntes;
-que nadam livremente por atividade própria;
-que são restritos ao fundo.

a) planctônicos, nectônicos e bentônicos.
b) planctônicos, bentônicos e nectônicos.
c) nectônicos, bentônicos e planctônicos.
d) nectônicos, planctônicos e bentônicos.
e) bentônicos, planctônicos e nectônicos.


Parte II: Cadeias alimentares

1) (UFF) Os principais produtores da cadeia biológica marinha são:

a) protozoários e copépodes;
b) medusas e corais;
c) diatomáceas e dinoflagelados;
d) organismos da fauna planctônica;
e) organismos da fauna bentônica.

2) (UFRJ) As espécies de capim que crescem nos campos da Austrália podem ser diferentes das que existem na América ou na África, mas todas têm a mesma função: são produtores dos ecossistemas de campo. Nos campos da Austrália vivem cangurus, nos da África há zebras e na América do Norte há bisões. Todos esses animais exercem em seus ecossistemas a função de:

a) consumidores primários
b) consumidores secundários
c) consumidores terciários
d) decompositores
e) parasitas

3) Em seu livro pesquise figuras de teias alimentares definindo quem são os produtores, consumidores primários, secundários e terciários. (lembre-se: um consumidor pode ocupar níveis tróficos distintos em uma mesma teia).


4) Tendo em vista os conceitos de CADEIA e TEIA alimentar, bem como de POPULAÇÃO e COMUNIDADE, podemos afirmar que:

a) A preá, a cobra e o gavião representam uma população e um exemplo de uma cadeia alimentar.
b) O conjunto de preás da região formam uma população e os consumidores, entredevorando-se, formam uma teia alimentar.
c) Preás e cobras do charco formam uma população e, para as cobras, as preás são produtoras de alimento.
d) Preás, cobras e gaviões formam uma comunidade; as cobras são consumidores primários e os gaviões consumidores secundários.
e) O conceito de produtor está associado ao fornecimento de alimento e, de consumidor, àqueles que o utilizam.


5) Com referência à cadeia alimentar, marque a alternativa correta:

a) a energia contida no produtor diminui gradualmente, ao passar de consumidor a consumidor.
b) a energia do produtor aumenta gradualmente nos diferentes elementos da cadeia alimentar.
c) o potencial energético do produtor não sofre nenhuma alteração nos diferentes segmentos da cadeia alimentar.
d) na cadeia alimentar, como os animais são de tamanho diferentes , a quantidade energética do produtor sofre oscilações.
e) a complexidade da teia alimentar não interfere com a quantidade de energia transferida, que permanece inalterada.

6) (CESGRANRIO) Qual das alternativas a seguir responde corretamente a seguinte questão: “Que resultaria se desaparecesse do mar o fitoplâncton ?”

a) o equilíbrio ecológico desse ecossistema não sofreria alteração, visto que o fitoplâncton é constituído por seres apenas microscópios.
b) o zooplâncton ocuparia o seu lugar na cadeia alimentar, mantendo assim o equilíbrio ecológico do ecossistema.
c) a cadeia alimentar do ecossistema perderia o elo principal, pois do fitoplâncton depende praticamente toda a matéria orgânica necessária aos demais componentes bióticos.
d) o ecossistema não seria afetado visto que o plâncton é apenas um consumidor na cadeia alimentar.
e) o equilíbrio ecológico não seria alterado visto que nem todos os organismos marinhos se alimentam do fitoplâncton.


8) (UBERLÂNDIA) O aproveitamento das algas pelo homem torna-se cada vez mais acentuado. Em certos países asiáticos, as algas já fazem parte da dieta humana. Neste caso o homem comporta-se como:

a) consumidor primário.
b) consumidor secundário.
c) consumidor terciário.
d) produtor.
e) decompositor.

Parte III: Pirâmides Ecológicas

1) Considere a seguinte cadeia alimentar:
Árvore è Herbívoros è Parasitas dos herbívoros
Esquematize a pirâmide ecológica de número, biomassa e energia vista na cadeia alimentar citada.

2) Com relação ao fluxo de energia em um ecossistema é correto dizer que:

a) a quantidade de energia que um nível trófico recebe é superior à que será transferida para o nível seguinte.
b) o fluxo de energia na cadeia alimentar é unidirecional.
c) a energia luminosa é captada pelos organismos heterótrofos.
d) em uma pirâmide de energia, a base é sempre ocupada pelos consumidores primários.
e) no ápice de uma pirâmide de energia estão colocados os produtores.

3) (S. CARLOS) Em um ecossistema, com a passagem de energia de um nível trófico para outro, ela:

a) permanece igual.
b) aumenta sempre.
c) diminui sempre.
d) é totalmente perdida.
e) é totalmente aproveitada.

4) (MED - MOGI) A rede alimentar numa comunidade foi caracterizada com a "pirâmide de números", onde os animais:

a) na base são pequenos e abundantes e no topo são grandes e pouco numerosos.
b) na base são pequenos e pouco numerosos e no topo são grandes e abundantes.
c) na base são grandes e pouco numerosos e no topo são pequenos e abundantes.
d) na base são pequenos e abundantes e no topo são pequenos e pouco numerosos.
e) na base são pequenos e pouco numerosos e no topo são pequenos e abundantes.

5) (FUVEST) Um dos perigos da utilização de inseticidas clorados é que eles são muito estáveis e permanecem longo tempo nos ecossistemas. Em vista disso, dada a cadeia alimentar
capim inseto pássaro cobra gavião
é de esperar que a maior concentração de DDT por quilo de organismo seja encontrada em:

a) cobra
b) gavião
c) pássaro
d) inseto
e) capim

6) (FCC) Em uma lagoa são lançados inseticidas organoclorados. Dos organismos abaixo, os que irão apresentar, após algum tempo, maior concentração desses inseticidas são:

a) os caramujos
b) as garças
c) os peixes
d) os fitoplanctontes
e) os microcrustáceos

7) (PUC‑RS) Sabe‑se que a maioria dos tubarões são animais carnívoros e predadores. No entanto, há espécies de tubarões que se alimentam do plâncton, como, por exemplo, o chamado tubarão‑baleia. A principal vantagem dessas espécies planctófagas sobre as outras é que para elas houve um:

a) alongamento da cadeia alimentar.
b) maior desenvolvimento do aparelho mastigador.
c) menor desenvolvimento do aparelho branquial.
d) encurtamento da cadeia alimentar.
e) processo mais lento de evolução.

8) (Cesgranrio‑RJ) 0 equilíbrio biológico de uma comunidade depende da proporção existente entre produtores, consumidores e predadores. Assim, se:

a) o número de produtores e consumidores aumentar, o de predadores diminuirá,
b) o número de produtores diminuir, o de consumidores e predadores aumentará.
c) o número de consumidores diminuir, o de produtores aumentará e o de predadores diminuirá.
d) o número de predadores aumentar, o de produtores e consumidores aumentará.
e) o número de predadores aumentar, o de produtores e consumidores diminuirá.

9) (UFMT) Leia as afirmativas abaixo:

I. A energia introduzida no ecossistema sob a forma de luz é transformada, passando de organismo para organismo sob a forma de energia química,
lI. No fluxo energético, há perda de energia em cada elo da cadeia alimentar.
III. A transferência de energia na cadeia alimentar é unidirecional, tendo início pela ação dos decompositores.
IV. A energia química armazenada nos compostos orgânicos dos seus produtores é transferida para os demais componentes da cadeia e permanece estável.

Estão corretas as afirmativas:

a) I e II.
b) II e III.
c) III e IV.
d) I e III,
e) II e IV.

10) (UFSC) A pirâmide de números abaixo representada diz respeito à estrutura trófica de um determinado ecossisterna:

Assinale a seqüência correta de organismos que corresponde à seqüência crescente de algarismos romanos da pirâmide:

a) gramíneas, sapos, gafanhotos, gaviões, cobras.
b) gaviões, cobras, sapos, gafanhotos, gra­míneas.
c) gaviões, gafanhotos, gramíneas, sapos, cobras.
d) gramíneas, gafanhotos, sapos, cobras, ga­viões.
e) gramíneas, gafanhotos, gaviões, cobras, sapos.

11) (UA‑AM) Na base das chamadas pirâmides de energia estão os:

a) decompositores. d) consumidores secundários.
b) produtores e) consumidores terciários.
c) consumidores primários.

12) (Fuvest‑SP) Cobras que se alimentam exclusivamente de roedores são consideradas:

a) produtores.
b) consumidores primários.
c) consumidores secundários.
d) consumidores terciários,
e) decompositores.

segunda-feira, 14 de abril de 2008

Como Estudar: técnicas que podem ajudar a melhorar seu rendimento escolar

O que significa estudar?

Muitas pessoas se dizem "estudantes", mas na verdade desconhecem o verdadeiro sentido da palavra ESTUDAR.
Estudar é Trabalhar !
Não é somente reler um texto na última hora, um dia antes da prova e depois de obter o retorno, em forma de notas baixas, reclamar para si mesmo: - Puxa! Eu estudei tanto!!!!
Estudar é ir à procura da Verdade!
A meta do estudante deve ser: chegar a aprender, enxergar com seus próprios olhos.
Quando uma pessoa estuda algo, ela chega a ter uma opinião própria sobre determinado assunto não dependendo de opiniões alheias para tirar suas conclusões.


Estudo é trabalho Duro, Penoso e Exaustivo que requer Empenho, Dedicação e Perseverança.

Mas afinal de contas: Como estudar?

Existem algumas técnicas que auxiliam o estudante a alcançar seus objetivos.
Se estas técnicas forem seguidas, seguramente o sucesso será alcançado e o próprio aluno perceberá que pode ultrapassar seus limites...


Fator Externo


AMBIENTE


O ambiente propício para o estudo deverá ser:



  • sossegado,
  • com boa iluminação,
  • sem música,
  • com uma mesa - somente com os materiais básicos para o estudo para que não haja distração com outras coisas do tipo: fotos, revistas, etc,
  • uma cadeira confortável (para se manter uma boa postura durante o estudo),
    um bom dicionário não pode faltar.

Fator Interno


MOTIVAÇÃO E AUTO DISCIPLINA


"Um homem sem objetivos não sabe para onde vai"
Um fator que determina o bom estudo é a vontade de querer saber mais, sem esta vontade o aluno não chegará a nenhum lugar. Para que isto aconteça o aluno deve saber onde quer chegar, enfim, ter os seus objetivos bem definidos!!!
A auto disciplina entra aí como um auxiliar do estudante que deve treinar-se para ter domínio sobre a fantasia, imaginação, emoções e impulsos.
A constância vence as impressões de falso cansaço que freqüentemente nos assaltam.



Planejamento e Organização

TEMPO


É importante que o aluno separe um tempo para estudar.
A escolha deste período é individual, pois cada pessoa tem os seus compromissos pessoais no decorrer da semana. Mas se faz necessário um empenho por parte do estudante para descobrir seus horários vagos e se dedicar ao estudo.
Descobrir os períodos de tempo vagos.
Selecionar aqueles períodos do dia em que você se sente mais "disposto"(Ex: há pessoas que trabalham melhor à noite, outros logo ao amanhecer...)
Separar pelo menos duas horas para estudo, mas, entre uma hora e outra descansar 15 minutos (saia do ambiente de estudo e faça algo para descansar a mente).
Somente em último caso estude mais que estas 2 horas porque é melhor que você tenha 2 horas de estudo por dia com uma certa freqüência ( por exemplo:4 vezes por semana) do que 4 horas em um só dia.

Anotações em Sala de Aula

As anotações em sala de aula são muito importantes para o estudo, pois elas são pessoais, ou seja, o aluno escreve com suas palavras o que está entendendo da aula, quando nós anotamos algo estamos usando não somente as memórias visual e auditiva. Quando escrevemos algo memorizamos mais!!!!!
Prepare um caderno para anotações ou utilize o próprio caderno da matéria a ser estudada, porque quando fazemos anotações em qualquer folha corremos o risco de perdê-la!!!
Crie o hábito de rever as anotações quando chegar em casa, ao revê-las podemos relembrar coisas importantes que deixamos de anotar durante a aula.
As anotações também podem ser feitas em forma de "MIND MAPPING" (mapas mentais).


A imagem abaixo é um "mind mapping" para um texto sobre aspectos ambientais a serem estudados no desenvolvimento industrial.


Obs- Maiores detalhes sobre a técnica do mapa mental em:

http://criatividade.files.wordpress.com/2007/03/mapa-mental.pdf




Saiba tirar o maior proveito de suas anotações


Escrever cada palavra dita pelo professor em sala de aula não garante o entendimento sobre o assunto. Existem estudantes que se dão bem com anotações em moldes de mapas mentais, baseando-se em palavras-chave, com indicadores. Esta é uma metodologia mais visual, com a qual o eles conseguem, depois, relacionar o mapa mental com o que recordam das aulas.


Outro método conhecido são as anotações lineares, com frases importantes e observações indispensáveis para estudar posteriormente. Muitos utilizam recursos como sublinhar palavras e temas de importância.


Outra técnica em anotações é a boa utilização de abreviaturas. Muitas vezes abreviamos uma palavra, porém, posteriormente, não entendemos seu significado. É preciso desenvolver abreviaturas padronizadas e utilizar algumas já conhecidas, como: C. (cerca de) Cap. (capítulo), i.e (id est = isto é), entre outras.

Obs.: Estas anotações são muito úteis também para serem usadas durante: Palestras, Exposições de Trabalhos, Vídeos, etc.


Estudando em Casa

Com o hábito saudável de estudar com uma certa constância você nunca estará com muitas matérias "difíceis" para "tentar decifrar"!
Tudo será uma grande REVISÃO deixando o estudante mais despreocupado, pois ele tem o domínio da matéria!!!

1º Passo
Ler o conteúdo a ser estudado despreocupadamente.
2º Passo
Ler o conteúdo sublinhando o que você está achando mais importante no texto.
3º Passo
Fazer um questionário sobre o que foi lido. (lembre-se que este material é seu por isso tente abordar todos os aspectos do texto!!!! Não seja um traidor de si mesmo!!)
4º Passo
Fazer um "Mapa Mental" do material (observando cores diferentes para as ramificações)
5º Passo
Se houver exercícios para serem feitos a hora é agora. Depois de ter seguido todos estes passos você não encontrará dificuldades em resolvê-los


Dica de Aprofundamento




Muitos alunos ficam apenas com o que o professor aborda em sala de aula e por este motivo, muitas vezes, não chegam a compreender o conteúdo.
Uma dica legal para que o estudante finalmente se liberte e possa discutir e analisar os fatos com mais profundidade é a PESQUISA.
Muitas vezes atitudes simples nos ajudam a ter mais conhecimento sobre fatos e, por este motivo, ser vista como uma pessoa "interessada".
Levar para a sala de aula um recorte de jornal, ou de uma revista sobre o tema estudado é um modo simples de aprofundamento.
Quando a matéria requer exercícios, como por exemplo matemática, o estudante deve procurar em livros de outros autores exercícios diferentes, e a partir destes, o próprio aluno poderá criar os seus.



Estudando Exatas

A matemática sempre foi um "bicho de 7 cabeças" para o estudante.
Com a aplicação do estudo sistematizado esta MÁ FAMA deverá sumir!!!

As dicas são basicamente as mesmas:




Prestar atenção às aulas fazendo anotações
Tentar resolver alguns exercícios em sala, formulando assim perguntas para o professor.
Quando chegar em casa: REVISÃO!!! Escreva observações e perguntas, se as tiver.
Pesquisar outros livros é muito importante para o domínio da matéria!!!
Dica
"PERGUNTAR É SINÔNIMO DE INTELIGÊNCIA E INTERESSE, POIS QUEM NÃO PERGUNTA É PORQUE PROVAVELMENTE ESTÁ COM A MENTE VOANDO FORA DA SALA DE AULA"
Seguindo estes conselhos práticos o estudante, sem sombra de dúvidas, irá alcançar êxito em sua carreira e, é claro, que este êxito se refletirá em boas notas!!!!
BONS ESTUDOS!

terça-feira, 18 de março de 2008

Técnicas para realizar provas e testes

Muito alunos me pedem dicas para o momento de realizar a prova. Por incrível que pareça o planejamento do ato de realizar uma avaliação pode melhorar a sua nota.
Então, algumas dicas para melhorar seu desempenho durante a feição de testes, provas e vestibulares.
Grande abraço
Prof. Augusto César



Procure calcular bem o tempo da prova, reservando alguns minutos para uma revisão final antes de entregá-la. Lembre-se: use todo o tempo disponível. Não tenha pressa em entregar a prova.


Não se perturbe se quase todos os colegas já tiverem terminando. Cada um deve se preocupar com seu próprio ritmo. O importante é fazer uma boa prova e não bater recorde de velocidade!

Preste atenção ao que o professor pedir que você faça na prova. Verbos como "definir", "explicar", "comparar", "exemplificar", "relacionar" têm um significado muito preciso. Se você "traduzir" mal.


Digamos que o professor peça que você defina um cubo. Se você escrever: "Um cubo é por exemplo, um dado", você errou! Uma coisa não é "por exemplo" nada! Uma coisa é somente aquela coisa e pronto. O certo seria você responder assim: "Sólido que tem seis faces quadradas iguais". Se o professor pedisse para "Exemplificar"um cubo, estaria certo.

Do mesmo modo, muita gente erra quando a pergunta pede para comparar ou relacionar duas coisas. Nesse caso, não basta definir cada uma delas, lado a lado. O que o professor quer é que você analise cada uma e veja quais as semelhanças e diferenças existentes entre elas, comparando uma à outra. É preciso pensar.


Também dá o maior problema quando o problema pede para "explicar" alguma coisa. Nesse caso, é preciso explicar mesmo, dar detalhes sobre a tal coisa. Não basta definir e pronto! "Explicar" quer dizer "desdobrar", "deixar claro".

Não adianta querer escrever mais que o professor pediu, pretendendo assim, melhorar a nota. Você tem de ser objetivo e responder apenas o que foi solicitado. Lembre-se de que, se tentar enrolar e fazer mais do que foi pedido, você estará aumentando as suas chances de errar!

Quando você não souber uma questão, é sempre bom tentar resolvê-la. Muitos professores dão parte da nota da questão quando descobrem que o aluno fez um esforço para acertar.


Bom estudo!

segunda-feira, 17 de março de 2008

O que é Janela Imunológica?


A janela imunológica é o período entre a contaminação e a possibilidade de detecção do vírus no organismo; é o tempo compreendido entre a aquisição da infecção e a soroconversão. Quando um indivíduo se expõe a alguma situação de risco e contrai o HIV, o sistema imunológico reconhece sua presença e dá início à produção de anticorpos anti-HIV, na tentativa de neutralizar seus efeitos. O HIV, porém, vai se alojar dentro de algumas células do organismo, inclusive dentro das células coordenadoras do sistema imunológico (os linfócitos). Após a infecção, o organismo leva de duas a doze semanas para produzir uma certa quantidade de anticorpos que possam ser detectados pelo exame de sangue específico e este período é chamado de "janela imunológica", ou seja, é o tempo entre a infecção pelo vírus e a soroconversão (quando os anticorpos passam a ser detectáveis no sangue e os testes sorológicos tornam-se positivos). O teste, que deve ser repetido, em três e seis meses, detecta os anticorpos do vírus e não o vírus em si . Caso o teste seja feito durante a "janela imunológica", é provável que dê um resultado falso-negativo, embora a pessoa já esteja infectada pelo HIV e possa transmiti-lo a outras pessoas.
Logo que infectado, o portador pode transmitir o vírus a outras pessoas, mesmo que sua presença só possa ser identificada semanas mais tarde. Teoricamente, no período da "janela imunológica" o risco de transmissão do HIV é maior do que no período pós-soroconversão assintomático, porque a taxa de replicação do HIV é alta, uma vez que a pessoa infectada ainda não desenvolveu uma resposta imune contra o HIV.
A s pessoas contaminadas pelo vírus HIV, mas que não desenvolveram a doença, e/ou nem apresentaram sintomas são chamadas de soropositivos, portadores assintomáticos ou portadores sadios . O que as caracteriza é o fato de que apesar da contaminação pelo HIV, elas não apresentam qualquer sintoma da doença podendo este estágio durar por toda a vida do indivíduo. Não confundir: aidéticos são os portadores do vírus que já desenvolveram a doença. Ainda não é possível saber quando algum portador do vírus vai desenvolver sintomas da doença ou mesmo a Aids (infecção aguda generalizada). Isso amplifica o conceito de sexo seguro e transfusões com segurança.

domingo, 24 de fevereiro de 2008

Epidemias de Gripe aviária: um caso de salto parasitário


Nós vimos em sala de aula que salto parasitário se estabelece quando uma cepa viral passa, por mutação, a ter capacidade de parasitar outro tipo de célula ou outra espécie que antes não o fazia. Isso ocorre porque vírus são parasitas extremamente específicos e só realizam a acoplagem e inoculação do vírion em um determinado padrão celular (salvo mutações).


Seguem duas interessantes e assustadoras reportagens, extraídas a pouco da Folha de São Paulo, que demonstram casos do salto parasitário.


Nova morte por gripe aviária aumenta para 104 as vítimas na Indonésia
da Efe, em Jacarta

Um jovem de 16 anos morreu por causa da gripe aviária na Indonésia, elevando para 104 o total de mortos no país mais afetado pela doença, informaram as autoridades de saúde neste sábado.
O adolescente morreu no último dia 10 na cidade de Solo (cerca de 450 quilômetros a sudeste de Jacarta), segundo comunicado publicado no site do Ministério da Saúde. Ele foi internada em 3 de fevereiro, após apresentar sintomas da doença, e os exames deram positivo para a cepa H5N1, a mais fatal das variantes conhecidas da gripe aviária.
A Indonésia se transformou no começo do ano no primeiro país a superar as cem vítimas fatais por causa da doença, que se transformou em endêmica nas ilhas de Java (a mais povoada), Sumatra e Bali, assim como na região meridional das Célebes.
A FAO (Organização das Nações Unidas para a Alimentação e a Agricultura) advertiu recentemente que os recentes focos da doença em vários países mostram que o vírus continua sendo uma ameaça em escala global.
Os vizinhos da família do adolescente têm galinhas contaminadas e o garoto teria matado uma delas antes de apresentar os sintomas da doença, segundo o ministério.
Segundo a contagem divulgada ontem pela WHO (Organização Mundial da Saúde, na sigla em inglês), desde 2003 já foram relatados 361 casos da doença --incluindo neste total as 227 mortes já registradas (a organização registra apenas casos confirmados após exames laboratoriais).
O vírus H5N1 tem se propagado rapidamente por todo o mundo, primeiro em aves de curral e depois em aves silvestres. A doença matou milhões de animais em mais de 60 países, a maioria desde 2003, mas o vírus ainda não sofreu mutações suficientes para se transformar em uma causa de doença comum entre humanos.


Indonésia registra segunda morte por gripe aviária nas últimas 24 horas
da Efe, em Jacarta

Um bebê de três anos morreu por causa da gripe aviária, a segunda vítima nas últimas 24 horas, o que aumenta para 105 o total de mortos pela doença no país mais afetado do mundo pelo vírus, informaram neste domingo (17) as autoridades sanitárias.
O menor morreu na sexta-feira em um hospital da capital, confirmou um porta-voz do Ministério da Saúde, segundo a imprensa local. As análises feitas deram positivo para a cepa H5N1, a mais mortífera do vírus.
Há menos de 24 horas, um jovem de 16 anos também morreu por gripe aviária na cidade de Solo, a cerca de 450 quilômetros ao sudeste de Jacarta.
A Indonésia se transformou no começo do ano na primeira nação que superou as cem vítimas mortais da doença, que se tornou endêmica nas ilhas de Java (a mais povoada), Sumatra e Bali, assim como na região meridional das Célebes.
A FAO (Organização das Nações Unidas para Agricultura e Alimentação) advertiu recentemente que os últimos focos da doença em vários países demonstram que o vírus continua sendo uma ameaça em escala global.



Vírus H5N1

domingo, 17 de fevereiro de 2008

Robôs 'terão inteligência humana em 20 anos', dizem especialistas


Em 20 anos, os robôs poderão ser tão inteligentes quanto os humanos, segundo projeções de especialistas da Associação Americana para o Avanço da Ciência.
De acordo com os especialistas, reunidos neste fim de semana nos Estados Unidos para discutir os 14 maiores desafios da humanidade neste século, máquinas e humanos poderão "se fundir" num futuro não muito distante.
Para o engenheiro Ray Kurzweil, a humanidade está à beira de avanços antes inimagináveis, como a instalação de robôs minúsculos no cérebro, que o tornariam "mais inteligente e saudável".
"Nós poderemos ter nanobots (chips) inteligentes que entrariam no cérebro a partir dos vasos capilares e poderão interagir diretamente com nossos neurônios biológicos para melhorar a capacidade de memória, por exemplo", disse ele, em entrevista à BBC.



"Isso é parte da realidade da nossa civilização", disse ele.






O engenheiro acredita que em 2029, a humanidade terá os recursos de inteligência artificial necessários "para que máquinas atinjam a inteligência humana, inclusive a inteligência emocional".
Ray Kurzweil acredita que será possível implantar no cérebro um computador do tamanho de um grão de ervilha para substituir neurônios destruídos pelo Mal de Parkinson.
"A última geração deste implante neural permite que se baixe um software para um computador dentro do cérebro do paciente", explica ele.
"E isso não é um experimento, já é uma terapia aprovada para o tratamento de Parkinson. Isso significa que o estamos fazendo grandes progressos".
Para os especialistas, alguns dos grandes desafios para a humanidade neste século incluem a resolução de problemas com fontes de energia alternativa, o desenvolvimento de realidade virtual, e o acesso à água potável.

segunda-feira, 31 de dezembro de 2007

Um ano de 2008 repleto de saúde, alegria e sucesso

Queridos alunos, amigos, colaboradores e leitores;

O Vídeo abaixo expressa meus sinceros desejos a você e a sua família. Que Deus ilumine seu caminho lhe abençoando com alegria, paz, saúde e muito sucesso em seus projetos e objetivos. Feliz 2008 contando com sua parceria e amizade.

segunda-feira, 24 de dezembro de 2007

Feliz Natal e um ano de 2008 com muitas felicidades!

Queridos amigos, alunos e leitores;

Obrigado pela companhia neste ano e ótimas festas. Que o natal represente a união e paz entre as famílias. Que 2008 seja trilhado por sorrisos e muito sucesso.

quinta-feira, 22 de novembro de 2007

Estudo Dirigido para a Recuperação - 1º ano do E.M 2007

Introdução a Biologia (níveis de organização)






Questão 01 - Defina cada um dos níveis de organização vistos abaixo;












Questão 02- Dos níveis organizacionais da matéria, vistos na questão anterior, quais são os alvos de estudo das ciências;




(a) Bioquímica


(b) Biologia celular


(c) Histologia


(d) Fisiologia e anatomia


(e) Ecologia



Questão 03- Classifique os termos em negrito vistos abaixo segundo os níveis de organização vistos no estudo da matéria.




Texto 01:


O mal-do-Panamá é causado por Fusarium oxysporum f. sp. cubense (E.F. Smith) Sn e Hansen. As principais formas de disseminação da doença são o contato dos sistemas radiculares de plantas sadias com esporos liberados por plantas doentes e, em muitas áreas, o uso de material de plantio contaminado. O fungo também é disseminado por água de irrigação, de drenagem, de inundação, assim como pelo homem, por animais e equipamentos.




Texto 2:


A cartilagem, é elástica e flexível, branco ou acinzentado, aderente às superfícies articulares dos ossos. Também é encontrado em outros locais como na orelha, na ponta do nariz. É formado por condrócitos e condroblastos, revestido pelo pericôndrio (fibrocartilagem nao possui pericondrio). O tecido serve para dar forma e sustentação a algumas partes do corpo, mas com menor rigidez que os ossos e também serve para não dar atrito entre os ossos. No tecido cartilaginoso não existem vasos sanguíneos, nervos e vasos linfaticos.





Texto 3:


O meio ambiente biótico inclui alimentos, plantas e animais, e suas relações recíprocas e com o meio abiótico. A sobrevivência e o bem-estar do homem dependem grandemente dos alimentos que come, tais como frutas, verduras e carne. Depende igualmente de suas associações com outros seres vivos. Por exemplo, algumas bactérias do sistema digestivo do homem ajudam-no a digerir certos alimentos.
Os fatores sociais e culturais que cercam o homem são uma parte importante de seu meio ambiente biótico. Seu sistema nervoso altamente desenvolvido tornou possível a memória, o raciocínio e a comunicação. Os seres humanos ensinam a seus filhos e aos seus companheiros o que aprenderam. Pela transmissão dos conhecimentos, o homem desenvolveu a religião, a arte, a música, a literatura, a tecnologia e a ciência. A herança cultural e a herança biológica do homem possibilitaram-lhe progredir além de qualquer outro animal no controle do meio ambiente. Nas últimas décadas, ele começou a explorar o meio ambiente do espaço cósmico.
Todo ser vivo se encontra em um meio que lhe condiciona a evolução de acordo com o seu patrimônio hereditário. A reação evolução sobre o patrimônio leva à individualização dos seres e a sua adaptação ao modo de vida. Quando o meio muda, o organismo reage através de uma nova adaptação (dentro da faixa permitida pelo patrimônio hereditário) que, segundo Lamarck, seria sempre eficaz, mas que, na realidade, pode ser prejudicial e agravar as conseqüências da mudança. Por exemplo, alterações bruscas como as que geralmente ocorrem em lagoas acarretam muitas mortes.





Bioquímica




Questão 04 - Quais são as 3 formas de substâncias inorgânicas e as 4 formas de subtâncias inorgânicas que formam os seres vivos? Cite exemplo de estruturas vitais formadas por cada uma das substâncias anteriormente citadas.






Questão 05- Na figura abaixo verificamos os órgãos que ministram a principal forma de sustentação corpórea de seres vertebrados.








Como se classifica, diante a classificação de componentes dos seres vivos, as substâncias que conferem dureza destes órgãos? Tais substâncias são sub-divididas entre mobilizadas e imobilizadas. No caso das substâncias analisadas nesta questão, como seria a classificação completa? Justifique sua resposta com base nos conceitos de bioquímica e fisiologia.



Questão 06- Há pelo menos 3 fatores que influenciam o teor de água em uma estrutura biológica. Descreva-os e disserte sobre exemplos práticos que ilustram tal teoria sobre a variabilidade de composição química dos seres vivos.



Questão 07- Descreva 5 funções da água nos organismos vivos. A água só se enquadra como solvente de reações nos organismos ou pode ser reagente e produto de processos bioquímicos? Justifique sua resposta com exemplos.



Questão 08- Liste 4 sais mobilizados ou solúveis que atuam no metabolismo dos seres vivos e onde são encontrados na estrutura de um indivíduo.



Questão 09- Os carboidratos são as biomoléculas mais abundantes na natureza, apresentam como fórmula geral: [C(H2O)]n, daí o nome "carboidrato", ou "hidratos de carbono" e são moléculas que desempenham uma ampla variedade de funções. Sobre esta biomolécula respondaç


(a) Como são classificadas segundo o número de monômeros (neste caso monossacarídeos) interligados?


(b) Dê exemplos de açúcares, glicídios ou carboidratos de cada classificação do item anterior.


(c) Quais são as duas grandes funções dos carboidratos nos organismos vivos?


(d) Como ocorre o armazenamento de carboidratos nos animais e nas plantas?


(e) A celulose é o carboidrato mais abundante na biosfera. Por que razão nós, seres humanos, não digerimos este açúcar?


Questão 10 - Como são denominados os carboidratos que constituem os monômeros do DNA e do RNA? Qual é a função destas biomoléculas na estrutura destes ácidos nucléicos?


Questão 11 - Como se denomina o polissacarídeo comum na superfície externa de células animais? Qual é a sua função na fisiologia destes seres vivos?


Questão 12 - Lipídeos definem um conjunto de substâncias químicas que, ao contrário das outras classes de compostos orgânicos, não são caracterizadas por algum grupo funcional comum, e sim pela sua alta solubilidade em solventes orgânicos e baixa solubilidade em água. Juntamente com as proteínas, ácidos nucléicos e carbo-hidratos, os lipídios são componentes essenciais das estruturas biológicas, e fazem parte de um grupo conhecido como biomoléculas. Os lipídios se encontram distribuidos em todos os tecidos, principalmente nas membranas celulares e nas células de gordura. Sobre esta biomolécula responda;


(a) Quais são as principais formas de lipídeos de acordo com o seu estado físico a temperatura ambiente?


(b) Descreva 3 funções dos lipídeos nos organismos vivos.


(c) Qual é o tipo de lipídeo que constitue a membrana celular? Como tais lipídeos se dispõe para formar a membrana celular e qual é a razão de tal disposição para a manutenção das características da célula.


Questão - O que é e qual a função dos ácidos nucléicos nos seres vivos? Descreva 5 características do DNA (vista nos modelos de Watson e Crick - ver texto no blog ou caderno) e 5 características do RNA. Cite 4 diferenças entre o DNA e o RNA incluindo função dentro da genética molecular



Questão 13 - Quantas pontes ou ligações de hidrogênio existe entre citosina e guanina e entre timinia e adenina quando nos referimos a ligação entre fitas de uma macromolécula de DNA?
A partir das fitas de DNA abaixo, respoda; (questões de ? a ?)



CCTAGACGAACGACGACGACGAACGAGGC
GGATCTGCTTGCTGCTGCTGCTTGCTCCG



GGCGCGCCGGGGCGTTACTAGCGAGCTAC
CCGCGCGGCCCCGCAATAGATCGCTCGATG



Questão 14- Qual é a porcentagem de citosina, guanina, timina, adenina e uracil vista no RNA transcrito das moléculas de DNA acima, considerando que a fita molde é aquela com maior quantidade de citosina?



Questão 15- Qual é a sequência de aminoácidos vista nos peptídeos produtos da tradução baseadas nas moléculas de DNA acima? (veja a tabela de relação de códons e aminoácidos no seu livro)?



Questão 16 - Qual é a denominação dos aparelhos enzimáticos vistos no processo de transcrição e replicação das moléculas de DNA acima?



Questão 17 - Como os nucleotídeos se ligam entre si na mesma fita e entre fitas distintas na mesma macromolécula de DNA?



Questão 18- Dos exemplos de proteínas abaixo, cite sua função e onde é encontrada (pesquise em seus livros e cadernos);




Queratina
Neurotransmissor
Bomba de sódio/potássio
Hemoglobina
Amilase
lipases
Superóxido dismutase
Miosina
Actina
Albumina



Questão 19- Esquematize dois aminoácidos e os ligue através de uma ligação peptídica. Quantos carbonos, hidrogênios, oxigênios e nitrogênios existem neste dipeptídeo após a ligação ser efetivada? (Considere que o grupo R de um aminoácido é o H e no outro aminoácido um NH3)





Questão 20- Muitas proteínas são produzidas e eliminadas pelas células. Esses dois processos são conhecidos, respectivamente, por síntese de proteínas e secreção celular e dependem de vários componentes celulares: gene (DNA), RNA mensageiro (RNAm), RNA transportador (RNAt), ribossomos e retículo endoplasmático granuloso (REG). Cite o papel de cada um dos omponentes nesses processos.



Questão 21- Descreva a definição de estrutura primária, secundária, terciária, quaternária de uma proteína. Qual são as estruturas funcionais? Por que?



Questão 22- Descreva 3 modos pela qual uma proteína pode ser desnaturada? Qual é o problema deste processo para o organismo? Cite um sintoma visto em doenças humanas que pode levar a desnaturação sistêmica de proteínas no organismo afetado.




BIOLOGIA CELULAR


Questão 23- Cite pelo menos 3 diferenças entre;
(a) Célula procariótica e célula eucariótica
(b) Célula animal e célula vegetal



Questão 24 - O modelo abaixo representa a configuração molecular da membrana celular, segundo Singer e Nicholson. Acerca do modelo proposto, responda as questões abaixo;


(a) Quais são os componentes orgânicos vistos nesta membrana? O modelo verificado se trata de uma membrana animal ou vegetal? Justifique sua resposta com base em dois fatos estruturais verificados na figura.
(b) Por qual estrutura ocorre a maior parte dos transportes através da membrana? Liste os tipos de transporte que ocorrem através da membrana celular e como estes transportes são classificados segundo o gasto de energia, sentido da migração de substâncias segundo o gradiente de concentração e espontaneidade.
(c) As porções 1 e 2 indicam regiões com comportamento distinto em relação a solubilidade em água. Em relação a tal fato, qual é a razão da disposição de porções hidrofílicas e hidrofóbicas na membrana, afim de estabelecer o isolamento e controle interno de organização da célula?
(d) Quais são os dois tipos de organóides presentes em todas as categorias celulares vistos nos Reinos da biosfera?

Questão 25 - As células animais apresentam um revestimento externo específico, que facilita sua aderência, assim como reações a partículas estranhas, como, por exemplo, as células de um órgão transplantado. Como se denomina esse revestimento? Qual é a composição deste revestimento? Como estas moléculas do revestimento reconhecem ou não corpos e células estranhas? Qual é o principal sistema fisiológico que se utiliza deste mecanismo de reconhecimento?

Questão 26- Em que tipo de células é encontrada a parede celular? Pode-se afirmar que a parede celular e a membrana celular são estruturas semelhantes em composição e função? Justifique sua resposta com base na citologia e bioquímica.

Questão 27- Qual é a principal razão pela qual os vírus não podem ser considerados seres vivos celulados (providos de células)?

Questão 28- Células vegetais, como as representadas na figura A, foram colocadas em uma determinada solução e, no fim do experimento, tinham aspecto semelhante ao da figura B.





De acordo com a situação, induza sobre as concentrações de solutos dentro e fora da célula. Como se denomina o tipo de transporte realizado pela célula acima? Por que a parede celular não se deformou?

Questão 29 - Um peixe tipicamente marinho é introduzido em um tanque contendo água doce. Analisando o balanço osmótico, o que ocorrerá com o corpo e estruturas orgânicas deste peixe?

Questão 30- Certos tipos de moléculas atravessam isoladamente a membrana plasmática e penetram no citoplasma. Também existem processos nos quais grandes quantidades de material passa para o interior da célula. Estes dois processos têm a mesma natureza de transporte? Como se denomina o transporte na primeira e segunda situação.

Questão 31- Três funis, contendo substâncias diferentes, porém em mesmas quantidades, foram colocados em um recipiente com uma determinada solução. Após algum tempo, o nível das substâncias no interior dos funis mostrava-se como no esquema abaixo:



Com base nestes dados, qual é a concentração de solutos na solução de referência?

Questão 32- Batatas, antes de serem fritas, são imersas em água com sal durante alguns minutos e depois escorridas em papel absorvente. Além de realçar o sabor, qual o efeito biológico acarretado por essa providência? Sobre esta situação e conhecimentos correlatos, julgue os itens abaixo, justificando os itens errados.

(1). As batatas amolecem tornando-se mais fáceis de mastigar.
(2). A água com sal hidrata o alimento tornando-o mais volumoso.
(3). A água lava o alimento e elimina as bactérias alojadas nas células.
(4). As batatas perdem água, fritam melhor e tornam-se mais crocantes.
(5). A água acelera os processos mitóticos, aumentando a massa das batatas.

Questão 33- É prática comum temperarmos a salada com sal, pimenta-do-reino, vinagre e azeite. Porém, depois de algum tempo, observamos que as folhas vão murchando. Como tal fato é explicado segundo a ciência da citologia?

Questão 34- O citoplasma de uma célula eucariótica está compreendido no espaço entre as membranas nuclear e citoplasmática. Sobre esse componente celular, julgue os itens abaixo, corrigindo o texto dos itens errados segundo as bases conceituais da biologia celular.

(1). É uma mistura complexa de substâncias orgânicas e inorgânicas.
(2). Ao microscópio eletrônico, apresenta-se heterogêneo.
(3). Existem, em seu interior, várias organelas que desempenham funções definidas.
(4). Pode-se observar facilmente o seu movimento de ciclose em células vegetais.
(5). Todas as organelas citoplasmáticas são comuns a todas as células de todos os grupos de seres vivos.
(6). Não apresenta microtúbulos em seu interior.

Questão 35- Esquematize uma célula eucariótica e procariótica, denominando suas estruturas internas e de fronteira. Faça um resumo sobre a função de cada um dos organóides descritos neste esquema.

Questão 36- Considere as seguintes estruturas celulares:
I- retículo endoplasmático.
II- complexo de Golgi.
III- grânulos de secreção.

A seqüência de estruturas em que seria encontrado um aminoácido radioativo, desde a entrada até sua saída da célula, é, respectivamente:
a) III, II, I
b) II, I , III
c) III, I, II
d) I, II, III
e) II, III, I
Justifique sua resposta com base em conhecimentos consolidados sobre a síntese protéica.


Questão 37- Os grânulos que, ao microscópio eletrônico, são vistos sobre o retículo endoplasmático são que tipo de organóide? Qual é a sua função? Tal atividade se equivale ao do mesmo organóide livre no citoplasma ou visto no interior da mitocôndria? Justifique sua resposta com base nas teorias vistas na citologia.

Questão 38- Uma célula animal que sintetiza, armazena e secreta enzimas, deverá ter bastante desenvolvidos ou em grande quantidade os organóides: mitocôndria, ribossomos, retículo endoplasmático granular e aparato golgiense. Qual é a razão funcional do metabolismo celular para ocorrer tal situação?

Questão 39 - Para que ocorra a digestão no interior de uma ameba, é necessário que os fagossomos fundam-se a que tipo de organóide? Qual é a origem deste organóide? Como é composto e qual é a sua função direta?

Questão 40- julgue os itens abaixo sobre a maneira como os seres vivos retiram a energia da glicose. Corrija os itens incorretos.

a) O organismo, como precisa de energia rapidamente e a todo tempo, faz a combustão da glicose em contato direto com o oxigênio.
b) Como a obtenção de energia não é sempre imediata, ela só é obtida quando a glicose reage com o oxigênio nas mitocôndrias.
c) A energia, por ser vital para a célula, é obtida antes mesmo de a glicose entrar nas mitocôndrias usando o oxigênio no citoplasma, com liberação de duas (02) moléculas de ATP (glicólise).
d) A energia da molécula de glicose é obtida através da oxidação dessa substância pela retirada de hidrogênios presos ao carbono (desidrogenações), que ocorre a nível de citoplasma e mitocôndrias.
e) A obtenção de moléculas de ATP é feita por enzimas chamadas desidrogenases (NAD) depois que a molécula de oxigênio quebra a glicose parcialmente no hialoplasma (glicólise).


ECOLOGIA

Questão 41- Defina ecossistema como nível de organização. Quais são os fatores bióticos e abióticos que definem um ecossistema/bioma?

Questão 42- Quais são os conceitos de HABITAT e NICHO ECOLÓGICO? Julgue os itens abaixo como certos e errados, justificando sua resposta segundo os conceitos trabalhados
(1). cobra e gavião ocupam o mesmo habitat.
(2). preá e cobra estão no mesmo nicho ecológico.
(3). gavião, cobra e preá estão no mesmo nicho ecológico.
(4). cobras neste mesmo local ocupam o mesmo nicho ecológico.
(5). preás podem ocupar o mesmo habitat, mas têm nichos ecológicos diferentes.

Questão 43- O ambiente descrito, com inúmeros animais e vegetais, à beira de um charco de água doce que, durante o dia, sofre flutuações de temperatura, luminosidade, maior ou menor pH e até alterações de salinidade, poderá ser classificado como um exemplo de:

a) biosfera
b) Pirâmide ecológica
c) biomassa
d) ecótone
e) ecossistema
Justifique sua resposta indicando a razão pela qual não marcou os itens que considerou errados.

Questão 44- Suponha que em um terreno coberto de capim gordura vivem saúvas, gafanhotos, pardais, preás e ratos-do-campo. Nesta região estão presentes quantas populações? Pode-se considerar a descrição deste texto como comunidade ou ecossistema? Justifique suas respostas com base nos conceitos organizacionais vistos na primeira parte deste estudo dirigido.

Questão 45 - Suponha duas plantas pertencentes ao mesmo gênero e vivendo juntas na mesma área. A espécie A tem raízes que se desenvolvem logo abaixo da superfície e a espécie B tem raízes profundas. Sobre as duas plantas e as descrições podemos afirmar que estas ocupam o mesmo nicho? Estas plantas competem por insumos do solo? Justifique suas respostas com base nos conceitos de nicho e dinâmicas de comunidades.

Questão 46- Mergulhando em águas costeiras, encontramos em uma rocha algas, cracas, anêmonas, estrelas-do-mar e ouriços-do-mar. As algas produzem seu próprio alimento. As cracas ingerem, com água, seres microscópios que nela vivem. As anêmonas comem pequenos peixes que ficam presos entre seus tentáculos. As estrelas-do-mar prendem seus “braços” os moluscos contra a rocha e sugam o animal de dentro da rocha. Os ouriços do mar raspam a rocha com seus “dentes”, alimentando-se de detritos. Em função do que foi descrito e de seus conhecimentos correlatos, esquematize uma teia alimentar diante os seres vivos desta situação. Quantas cadeias alimentares existem na teia esquematizada por você?

Questão 47- Quem são os principais produtores da cadeia biológica marinha? Por que se diz que tais seres são os principais produtores de oxigênio do planeta Terra e não as plantas terrestres?

Questão 48- Do texto abaixo, classifique os organismos dentro de um trofo da cadeia alimentar (produtor, consumidor primário, consumidor secundário, etc., decompositor)
“As espécies de capim que crescem nos campos da Austrália podem ser diferentes das que existem na América ou na África, mas todas têm a mesma função: são produtores dos ecossistemas de campo. Nos campos da Austrália vivem cangurus, nos da África há zebras e na América do Norte há bisões.”

Questão 49- Tendo em vista os conceitos de CADEIA e TEIA alimentar, bem como de POPULAÇÃO e COMUNIDADE, julgue os itens abaixo justificando os itens falsos com base nos conceitos ecológicos.
(1). A preá, a cobra e o gavião representam uma população e um exemplo de uma cadeia alimentar.
(2). O conjunto de preás da região forma uma população e os consumidores, entredevorando-se, formam uma teia alimentar.
(3). Preás e cobras do charco formam uma população e, para as cobras, as preás são produtoras de alimento.
(4). Preás, cobras e gaviões formam uma comunidade; as cobras são consumidores primários e os gaviões consumidores secundários.
(5). O conceito de produtor está associado ao fornecimento de alimento e, de consumidor, àqueles que o utilizam.
(6). A energia contida no produtor diminui gradualmente, ao passar de consumidor a consumidor.
(7). A energia do produtor aumenta gradualmente nos diferentes elementos da cadeia alimentar.
(8). O potencial energético do produtor não sofre nenhuma alteração nos diferentes segmentos da cadeia alimentar.
(9). Na cadeia alimentar, como os animais são de tamanho diferentes , a quantidade energética do produtor sofre oscilações.
(10). A complexidade da teia alimentar não interfere com a quantidade de energia transferida, que permanece inalterada.

Questão 50- Qual é o conceito de equilíbrio ecológico em relação ao número de indivíduos das populações de um ecossistema ao longo do tempo? Se uma ou mais destas populações tiverem seu número de indivíduos aumentados ou diminuídos demais em curto espaço de tempo, quais seriam as conseqüências diretas e indiretas nas outras populações conviventes?

Questão 51- Geralmente, nas pirâmides ecológicas, a base dos produtores é maior que o corpo e o pico piramidal correspondente aos consumidores. Qual é a razão desta disposição neste tipo gráfico (pirâmide) que expressa as relações quantitativas em um ecossistema? Pode haver a inversão desta pirâmide ecológica? Em que situações? Qual é a razão de ser impossível a inversão da pirâmide ecológica de energia?


Questão 52- Em um ecossistema, com a passagem de energia de um nível trófico para outro, esta sofre alteração quantitativa? Por quê?

Questão 53- Há 3 tipos de pirâmides ecológicas. Quais são estas? O que cada um dos tipos expressa em termos de quantidades em um ecossistema no que tange as relações entre os seres de uma comunidade?

Questão 54- Um dos perigos da utilização de inseticidas clorados é que eles são muito estáveis e permanecem longo tempo nos ecossistemas. Em vista disso, dada a cadeia alimentar

capim inseto pássaro cobra gavião


é de esperar que a maior concentração de DDT por quilo de organismo seja encontrada em qual trofo? Jusfique sua resposta com base na teoria de bioacumulação.


Questão 55- julgue as afirmativas abaixo corrigindo os textos incorretos

I. A energia introduzida no ecossistema sob a forma de luz é transformada, passando de organismo para organismo sob a forma de energia química,
lI. No fluxo energético, há perda de energia em cada elo da cadeia alimentar.
III. A transferência de energia na cadeia alimentar é unidirecional, tendo início pela ação dos decompositores.
IV. A energia química armazenada nos compostos orgânicos dos seus produtores é transferida para os demais componentes da cadeia e permanece estável.

Questão 56- “Em dois hectares de terra, foram plantadas 3.600 mudas de eucalipto sem ocorrer a retirada da vegetação nativa. Tal procedimento foi interpretada como uma ação com base em desenvolvimento sustentável”. Com base em conceitos ecológicos você concorda com tal procedimento como sendo um ato de desenvolvimento sustentável? Justifique sua resposta com base nos impactos ambientais sobre este ecossistema.

Questão 57- O tucunaré, peixe trazido da Amazônia para as lagoas de captação das usinas estabelecidas ou em construção nos rios Paraná, Tietê e Grande, adaptou-se às condições locais e serviu como elemento de controle das populações de piranhas que ameaçavam proliferar nos reservatórios das usinas hidrelétricas de Minas Gerais e São Paulo já que o primeiro se alimenta dos alevinos da segunda população além dos peixes adultos da mesma população ocuparem nichos semelhantes. O mesmo tucunaré terá sua criação incrementada na barragem de Itaipu, afastando o perigo do domínio das águas do Rio Paraná por cardumes de piranhas. Como se denomina tal procedimento de controle de populações? Qual é a relação ecológica entre o tucunaré e as piranhas? No caso de uma eliminação da população de piranhas, qual seria a conseqüência as outras populações deste ambiente aquático.

Questão 58- Considere uma cadeia alimentar constituída por fitoplâncton, peixes herbívoros e peixes carnívoros. O que acontece com as outras populações imediatamente após redução drástica dos peixes carnívoros?

Questão 59- Apesar de quase 4/5 da atmosfera serem constituídos de nitrogênio, apenas alguns seres têm a capacidade de aproveitar o nitrogênio em forma elementar para o seu metabolismo. Quais são os organismos capazes de fixar o nitrogênio do ar no solo? Qual é a substância produzida por estes organismos a partir do nitrogênio atmosférico? O que ocorre com esta substância produto sob a ação de outros organismos do solo capazes de metabolizar o nitrogênio molecular? Qual é o papel das plantas neste ciclo biogeoquímico que permite o acesso de substâncias nitrogenadas vitais a todos os seres vivos? Como o nitrogênio é devolvido para a atmosfera?

Questão 60- Uma forma natural de aumentar a quantidade de nitrogênio, disponível no solo sob a forma de nitratos, é alterar o cultivo de plantas não leguminosas com leguminosas, pois as últimas apresentam, nas suas raízes, módulos com bactérias capazes de fixar o nitrogênio atmosférico. Como se denomina este grupo de bactéria? Dê um exemplo de culturas agrícolas que poderiam ser utilizadas na rotação de cultura descrita acima.

Questão 61- É preocupação dos ecólogos o fato de que as calotas polares podem vir a sofrer um processo de descongelamento, em virtude de um aquecimento da atmosfera terrestre. Esse aquecimento, conseqüência de um desequilíbrio ecológico, decorre de quais ações humanas? Qual é o ciclo biogeoquímico relacionado ao aquecimento da atmosfera?

Questão 62- Esquematize o ciclo do carbono explicitando os fatores de emissão de carbono a atmosfera e o principal fator de fixação deste carbono para os seres vivos. Como o conceito de cadeia alimentar é inserido neste ciclo biogeoquímico?

Questão 63- Qual é o processo vital presente nos ciclos do oxigênio, do carbono e da água? Descreva a reação química que justifica sua resposta.

Questão 64- Suponhamos que o charco onde viva um preá e os outros seres vivos, com o decorrer dos tempos, vá lentamente se modificando. O espelho d’água diminua, pela progressiva invasão de novas plantas, assoreamento e a instalação de plantas mais duradouras; pelo surgimento de novos animais e desaparecimento de outros. O cenário se modifica. Como se denomina esse fenômeno? Esta descrição é uma forma primária ou secundária deste fenômeno ecológico? Justifique sua resposta com base em conceitos de dinâmica de comunidades.


Questão 65- Numa sucessão ecológica de comunidades, o que ocorre com a biomassa, diversidade e produtividade primária ao longo do processo? Como se denomina as fases da sucessão ecológicas com populações pioneiras, intermediárias e as mais diversificadas?

Questão 66- Descreva pelo menos 3 características vistas no bioma do cerrado em relação ao;

(a) Clima

(b) Solo

(c) Vegetação

(e) Distribuição de água na superfície

(f) Fauna

Questão 67- Quais são as outras duas formações savânicas no mundo semelhantes ao cerrado brasileiro? Qual é a explicação para lugares tão distintos, em continentes diferentes, possuírem biomas tão semelhantes?

Questão 68- Onde se localiza o cerrado brasileiro? É correto afirmar que o cerrado brasileiro é o ecossistema com o maior número de Ecótonos (ecótenes) do planeta Terra? Por que? Qual é a consequência deste fator para a biodiversidade do cerrado?
Questão 69 - Em relação a vegetação típica do cerrado (principalmente a observada no cerrado Stricto Sensu ), caracterize e estabeleça a justificativa evolutiva para tal característica em relação as;


(a) Folhas EX: Epiderme grossa e rígida, caduncas, podem apresentar anexos pelíferos - tais fatores evitam o excesso de transpiraçã e perda de água, principalmente na época da seca.
(b) Casca do tronco
(c) Raíz
(d) Tronco
(e) Sementes (ativação pró germinação na dormência)

Questão 70- Defina o que é Escleromorfismo Oligotrófico, fenômeno típico da vegetação no cerrado? Qual é a relação de tal fenômeno com a deficiência de água na superfície imediata do solo? E com as características minerais destes solo?

Questão 71 - Por que o solo do cerrado é ácido? Quais são os fatores que contribuem com tal acidez? Como tal fator influencia a fisiologia celular e sistêmica das plantas no cerrado?

Questão 72- O que é calagem (procedimento realizado no solo do cerrado) para que serve? Existe algum processo de calagem natural, como ocorre tal fenômeno e como este influencia a disposição da vegetação no cerrado?

Questão 73 - Usando argumentação de padrões de solo, distribuição e presença de água, equilíbrio entre padrões de vegetação (gramíneas, arbustivas e arbóreas) e outros fatores; caracterize as principais formações do cerrado correlacionadas abaixo;

(a) Campo limpo
(b) Campo sujo
(c) Campo rupestre
(d) Cerrado Stricto Sensu
(e) Cerrado Ralo
(f) Cerrado típico
(g) Cerradão
(f) Floresta ou mata de Galeria
(g) Floresta ou mata Ciliar
(h) Veredas

Questão 74 - Das formações observadas na questão anterior, quais são caracterizadas como;

(a) Formações Campestres ou cerradinho

(b) Formações savânicas

(c) Formações florestais

Qual é o predomínio de vegetação em cada uma destas formações no que tange a espécies gramíneas, arbustivas e arbóreas?

Questão 75- Como o fogo, na forma de incêndios ocasionais na época da seca, são importantes ao ecossistema do cerrado? Com base na leitura do livro, descreva pelo menos 4 fatores positivos do fogo sobre a manutenção das características do cerrado brasileiro.

Questão 76- Por que incêndios de grande proporção, geralmente de origem criminosas, não levam aos mesmos benefícios dos incêndios descritos na questão anterior? Quais são as razões de incêndios crimosos nas regiões de cerrado brasileiro?

segunda-feira, 19 de novembro de 2007

Estudo Dirigido Para a Prova do 4º Período 2007 - 8º ano - Ensino Fundamental

Finalizantes alunos;

Mais um estudo dirigido para a reta final de estudos.

Um grande abraço e ótimas férias.

Prof. Augusto César Willer


Estudo Dirigido - 4º período de 2007
(para o 8º ano do Ensino Fundamental)
Questão 01 - Esquematize dois neurônios conectados denominando e localizando as seguintes estruturas:
* Corpo Celular
* Dendritos
* Axônio
* Barra ou estrato mielínico
* Núcleo celular
* Vesículas pré-sinapticas
* Vesículas pós-sinápticas
* Fenda sináptica
Questão 02- Como se subdivide o sistema nervoso? Quais são os órgãos que constituem o sistema nervoso central (SNC)? Quais os órgãos que constituem o sistema nervoso periférico (SNP)?
Questão 03- Descreva duas funções, no mínimo, desempenhadas pelos órgãos que constituem o SNC:
(a) Cérebro
(b) Cerebelo
(c) Ponte
(d) Bulbo
(e) Medula espinhal
Questão 04 - Como se subdivide o sistema nervoso autônomo? Como estas partes do sistema atuam em um órgão onde estes agem? Cite 3 exemplos de ação do sistema nervoso autônomo simpático e parassimpático sobre órgãos distintos.
Questão 05 - Descreva 6 processos que ocorrem no organismo humano sob ação do hormônio adrenalina associado ao sistema nervoso autônomo? Em que situações a adrenalina e lançada na corrente sanguínea? Qual o órgão (glândula) que produz a adrenalina?
Questão 06- Sobre as anomalias mais comuns verificadas na visão humana responda;
(a) Miopia
a1- Onde se forma a imagem dentro do globo ocular ou do sitema visual?
a2- Qual é a forma do globo ocular em relação ao olho normal (sem anomalias)? Desenhe se for necessário para ilustrar a resposta.
a3- Como se comporta o cristalino em um indivíduo com tal anomalia na tentativa de focar de forma nítida a imagem?
a4- Como se denomina a lente que corrige tal anomalia? Como esta lente age no processo de correção?
(b) Hipermetropia

b1- Onde se forma a imagem dentro do globo ocular ou do sitema visual?
b2- Qual é a forma do globo ocular em relação ao olho normal (sem anomalias)? Desenhe se for necessário para ilustrar a resposta.
b3- Como se comporta o cristalino em um indivíduo com tal anomalia na tentativa de focar de forma nítida a imagem?
b4- Como se denomina a lente que corrige tal anomalia? Como esta lente age no processo de correção?
(c) Astigmatismo
c1- Onde se forma a imagem dentro do globo ocular ou do sitema visual?
c2- Qual é a forma do globo ocular em relação ao olho normal (sem anomalias)? Desenhe se for necessário para ilustrar a resposta.
c3- Como se comporta o cristalino em um indivíduo com tal anomalia na tentativa de focar de forma nítida a imagem?
c4- Como se denomina a lente que corrige tal anomalia? Como esta lente age no processo de correção?
Questão 07- Esquematize denominando as estruturas do ouvido ou orelha externa, média e interna? Qual é a função do pavilhão auditivo (orelha externa)? Qual é a função da cêra formada na orelha ou ouvido médio? Como ocorre a fisiologia (funcionamento) do tímpano e ossículos (estribo, bigorna e martelo) quando recebem uma vibração sonora? Qual é a relação entre a cóclea (caracol da orelha interna) e o nervo ótico (cuidado ótico é o nervo da audição, óptico é o da visão!)?
Questão 08 - Qual é a função do labirito (órgão da orelha interna) e o sistema de equilíbrio , controle de pressão interna em relação a pressão externa e processo de localização espacial?
Questão 09- Em que região da pele localiza-se as terminações nervosas responsáveis pelo tato? Cite 5 tipos de sensações atribuidas ao sentido do tato.
Questão 10 - Cite 5 glândulas exócrinas descrevendo onde estas se localizam e qual é o tipo de secreção/excreção produzidas por estas. Qual é a (são) a(s) função(ões) de cada uma destas secreções/excreções por você escolhida.
Questão 11- Por que a sensação de gustação e olfato tem uma origem de estímulo químico? Por que a gripe, alergias respiratórias e resfriados prejudicam a sensação de gustação mesmo estando as secreções obstruíndo especificamente a região da mucosa nasal?
Questão 12 - Em que regiões da coluna vertebral ocorrem os traumas que levam a;
(a) Morte por insuficiência respiratória e cardíaca?
(b) Tetrplegia
(c) Paraplegia total
(d) Paraplegia parcial
Questão 13 - Quais são os ossos que protegem o sistema nervoso central?
Questão 14 - O que é uma glândula endócrina? O que é hormônio? O que a difere de uma glândula exócrina em relação ao tipo de secreção e ao local de emissão deste material por ela produzido? Em relação as glândulas endócrinas abaixo citadas, descreva a denominação do(s) hormônio(s) produzido(s), função(ões) deste(s) hormônio(s), em que órgãos e/ou tecidos agem, como se denomina a doença causada pelo mal funcionamento desta glândula e uma breve descrição desta patolologia.
(a) Hipófise
(b) Tireóide
(c) Paratireóide
(d) Pâncreas endócrino
(e) Ovário
(f) Testículos
(g) Supra renal
Questão 15- "O sistema nervoso e endócrino funcionam em harmonia com o objetivo de manter a homeostase e a adaptação e percepção do meio pelo indivíduo". Em relação a sentença acima responda;
(a) Qual é a região do SNC e a glândula responsável pela interconexão dos dois sistemas?
(b) Qual é o sistema que verdadeiramente comanda o organismo? Justifique sua resposta com base na fisiologia do organismo humano.