segunda-feira, 31 de dezembro de 2007

Um ano de 2008 repleto de saúde, alegria e sucesso

Queridos alunos, amigos, colaboradores e leitores;

O Vídeo abaixo expressa meus sinceros desejos a você e a sua família. Que Deus ilumine seu caminho lhe abençoando com alegria, paz, saúde e muito sucesso em seus projetos e objetivos. Feliz 2008 contando com sua parceria e amizade.

segunda-feira, 24 de dezembro de 2007

Feliz Natal e um ano de 2008 com muitas felicidades!

Queridos amigos, alunos e leitores;

Obrigado pela companhia neste ano e ótimas festas. Que o natal represente a união e paz entre as famílias. Que 2008 seja trilhado por sorrisos e muito sucesso.

quinta-feira, 22 de novembro de 2007

Estudo Dirigido para a Recuperação - 1º ano do E.M 2007

Introdução a Biologia (níveis de organização)






Questão 01 - Defina cada um dos níveis de organização vistos abaixo;












Questão 02- Dos níveis organizacionais da matéria, vistos na questão anterior, quais são os alvos de estudo das ciências;




(a) Bioquímica


(b) Biologia celular


(c) Histologia


(d) Fisiologia e anatomia


(e) Ecologia



Questão 03- Classifique os termos em negrito vistos abaixo segundo os níveis de organização vistos no estudo da matéria.




Texto 01:


O mal-do-Panamá é causado por Fusarium oxysporum f. sp. cubense (E.F. Smith) Sn e Hansen. As principais formas de disseminação da doença são o contato dos sistemas radiculares de plantas sadias com esporos liberados por plantas doentes e, em muitas áreas, o uso de material de plantio contaminado. O fungo também é disseminado por água de irrigação, de drenagem, de inundação, assim como pelo homem, por animais e equipamentos.




Texto 2:


A cartilagem, é elástica e flexível, branco ou acinzentado, aderente às superfícies articulares dos ossos. Também é encontrado em outros locais como na orelha, na ponta do nariz. É formado por condrócitos e condroblastos, revestido pelo pericôndrio (fibrocartilagem nao possui pericondrio). O tecido serve para dar forma e sustentação a algumas partes do corpo, mas com menor rigidez que os ossos e também serve para não dar atrito entre os ossos. No tecido cartilaginoso não existem vasos sanguíneos, nervos e vasos linfaticos.





Texto 3:


O meio ambiente biótico inclui alimentos, plantas e animais, e suas relações recíprocas e com o meio abiótico. A sobrevivência e o bem-estar do homem dependem grandemente dos alimentos que come, tais como frutas, verduras e carne. Depende igualmente de suas associações com outros seres vivos. Por exemplo, algumas bactérias do sistema digestivo do homem ajudam-no a digerir certos alimentos.
Os fatores sociais e culturais que cercam o homem são uma parte importante de seu meio ambiente biótico. Seu sistema nervoso altamente desenvolvido tornou possível a memória, o raciocínio e a comunicação. Os seres humanos ensinam a seus filhos e aos seus companheiros o que aprenderam. Pela transmissão dos conhecimentos, o homem desenvolveu a religião, a arte, a música, a literatura, a tecnologia e a ciência. A herança cultural e a herança biológica do homem possibilitaram-lhe progredir além de qualquer outro animal no controle do meio ambiente. Nas últimas décadas, ele começou a explorar o meio ambiente do espaço cósmico.
Todo ser vivo se encontra em um meio que lhe condiciona a evolução de acordo com o seu patrimônio hereditário. A reação evolução sobre o patrimônio leva à individualização dos seres e a sua adaptação ao modo de vida. Quando o meio muda, o organismo reage através de uma nova adaptação (dentro da faixa permitida pelo patrimônio hereditário) que, segundo Lamarck, seria sempre eficaz, mas que, na realidade, pode ser prejudicial e agravar as conseqüências da mudança. Por exemplo, alterações bruscas como as que geralmente ocorrem em lagoas acarretam muitas mortes.





Bioquímica




Questão 04 - Quais são as 3 formas de substâncias inorgânicas e as 4 formas de subtâncias inorgânicas que formam os seres vivos? Cite exemplo de estruturas vitais formadas por cada uma das substâncias anteriormente citadas.






Questão 05- Na figura abaixo verificamos os órgãos que ministram a principal forma de sustentação corpórea de seres vertebrados.








Como se classifica, diante a classificação de componentes dos seres vivos, as substâncias que conferem dureza destes órgãos? Tais substâncias são sub-divididas entre mobilizadas e imobilizadas. No caso das substâncias analisadas nesta questão, como seria a classificação completa? Justifique sua resposta com base nos conceitos de bioquímica e fisiologia.



Questão 06- Há pelo menos 3 fatores que influenciam o teor de água em uma estrutura biológica. Descreva-os e disserte sobre exemplos práticos que ilustram tal teoria sobre a variabilidade de composição química dos seres vivos.



Questão 07- Descreva 5 funções da água nos organismos vivos. A água só se enquadra como solvente de reações nos organismos ou pode ser reagente e produto de processos bioquímicos? Justifique sua resposta com exemplos.



Questão 08- Liste 4 sais mobilizados ou solúveis que atuam no metabolismo dos seres vivos e onde são encontrados na estrutura de um indivíduo.



Questão 09- Os carboidratos são as biomoléculas mais abundantes na natureza, apresentam como fórmula geral: [C(H2O)]n, daí o nome "carboidrato", ou "hidratos de carbono" e são moléculas que desempenham uma ampla variedade de funções. Sobre esta biomolécula respondaç


(a) Como são classificadas segundo o número de monômeros (neste caso monossacarídeos) interligados?


(b) Dê exemplos de açúcares, glicídios ou carboidratos de cada classificação do item anterior.


(c) Quais são as duas grandes funções dos carboidratos nos organismos vivos?


(d) Como ocorre o armazenamento de carboidratos nos animais e nas plantas?


(e) A celulose é o carboidrato mais abundante na biosfera. Por que razão nós, seres humanos, não digerimos este açúcar?


Questão 10 - Como são denominados os carboidratos que constituem os monômeros do DNA e do RNA? Qual é a função destas biomoléculas na estrutura destes ácidos nucléicos?


Questão 11 - Como se denomina o polissacarídeo comum na superfície externa de células animais? Qual é a sua função na fisiologia destes seres vivos?


Questão 12 - Lipídeos definem um conjunto de substâncias químicas que, ao contrário das outras classes de compostos orgânicos, não são caracterizadas por algum grupo funcional comum, e sim pela sua alta solubilidade em solventes orgânicos e baixa solubilidade em água. Juntamente com as proteínas, ácidos nucléicos e carbo-hidratos, os lipídios são componentes essenciais das estruturas biológicas, e fazem parte de um grupo conhecido como biomoléculas. Os lipídios se encontram distribuidos em todos os tecidos, principalmente nas membranas celulares e nas células de gordura. Sobre esta biomolécula responda;


(a) Quais são as principais formas de lipídeos de acordo com o seu estado físico a temperatura ambiente?


(b) Descreva 3 funções dos lipídeos nos organismos vivos.


(c) Qual é o tipo de lipídeo que constitue a membrana celular? Como tais lipídeos se dispõe para formar a membrana celular e qual é a razão de tal disposição para a manutenção das características da célula.


Questão - O que é e qual a função dos ácidos nucléicos nos seres vivos? Descreva 5 características do DNA (vista nos modelos de Watson e Crick - ver texto no blog ou caderno) e 5 características do RNA. Cite 4 diferenças entre o DNA e o RNA incluindo função dentro da genética molecular



Questão 13 - Quantas pontes ou ligações de hidrogênio existe entre citosina e guanina e entre timinia e adenina quando nos referimos a ligação entre fitas de uma macromolécula de DNA?
A partir das fitas de DNA abaixo, respoda; (questões de ? a ?)



CCTAGACGAACGACGACGACGAACGAGGC
GGATCTGCTTGCTGCTGCTGCTTGCTCCG



GGCGCGCCGGGGCGTTACTAGCGAGCTAC
CCGCGCGGCCCCGCAATAGATCGCTCGATG



Questão 14- Qual é a porcentagem de citosina, guanina, timina, adenina e uracil vista no RNA transcrito das moléculas de DNA acima, considerando que a fita molde é aquela com maior quantidade de citosina?



Questão 15- Qual é a sequência de aminoácidos vista nos peptídeos produtos da tradução baseadas nas moléculas de DNA acima? (veja a tabela de relação de códons e aminoácidos no seu livro)?



Questão 16 - Qual é a denominação dos aparelhos enzimáticos vistos no processo de transcrição e replicação das moléculas de DNA acima?



Questão 17 - Como os nucleotídeos se ligam entre si na mesma fita e entre fitas distintas na mesma macromolécula de DNA?



Questão 18- Dos exemplos de proteínas abaixo, cite sua função e onde é encontrada (pesquise em seus livros e cadernos);




Queratina
Neurotransmissor
Bomba de sódio/potássio
Hemoglobina
Amilase
lipases
Superóxido dismutase
Miosina
Actina
Albumina



Questão 19- Esquematize dois aminoácidos e os ligue através de uma ligação peptídica. Quantos carbonos, hidrogênios, oxigênios e nitrogênios existem neste dipeptídeo após a ligação ser efetivada? (Considere que o grupo R de um aminoácido é o H e no outro aminoácido um NH3)





Questão 20- Muitas proteínas são produzidas e eliminadas pelas células. Esses dois processos são conhecidos, respectivamente, por síntese de proteínas e secreção celular e dependem de vários componentes celulares: gene (DNA), RNA mensageiro (RNAm), RNA transportador (RNAt), ribossomos e retículo endoplasmático granuloso (REG). Cite o papel de cada um dos omponentes nesses processos.



Questão 21- Descreva a definição de estrutura primária, secundária, terciária, quaternária de uma proteína. Qual são as estruturas funcionais? Por que?



Questão 22- Descreva 3 modos pela qual uma proteína pode ser desnaturada? Qual é o problema deste processo para o organismo? Cite um sintoma visto em doenças humanas que pode levar a desnaturação sistêmica de proteínas no organismo afetado.




BIOLOGIA CELULAR


Questão 23- Cite pelo menos 3 diferenças entre;
(a) Célula procariótica e célula eucariótica
(b) Célula animal e célula vegetal



Questão 24 - O modelo abaixo representa a configuração molecular da membrana celular, segundo Singer e Nicholson. Acerca do modelo proposto, responda as questões abaixo;


(a) Quais são os componentes orgânicos vistos nesta membrana? O modelo verificado se trata de uma membrana animal ou vegetal? Justifique sua resposta com base em dois fatos estruturais verificados na figura.
(b) Por qual estrutura ocorre a maior parte dos transportes através da membrana? Liste os tipos de transporte que ocorrem através da membrana celular e como estes transportes são classificados segundo o gasto de energia, sentido da migração de substâncias segundo o gradiente de concentração e espontaneidade.
(c) As porções 1 e 2 indicam regiões com comportamento distinto em relação a solubilidade em água. Em relação a tal fato, qual é a razão da disposição de porções hidrofílicas e hidrofóbicas na membrana, afim de estabelecer o isolamento e controle interno de organização da célula?
(d) Quais são os dois tipos de organóides presentes em todas as categorias celulares vistos nos Reinos da biosfera?

Questão 25 - As células animais apresentam um revestimento externo específico, que facilita sua aderência, assim como reações a partículas estranhas, como, por exemplo, as células de um órgão transplantado. Como se denomina esse revestimento? Qual é a composição deste revestimento? Como estas moléculas do revestimento reconhecem ou não corpos e células estranhas? Qual é o principal sistema fisiológico que se utiliza deste mecanismo de reconhecimento?

Questão 26- Em que tipo de células é encontrada a parede celular? Pode-se afirmar que a parede celular e a membrana celular são estruturas semelhantes em composição e função? Justifique sua resposta com base na citologia e bioquímica.

Questão 27- Qual é a principal razão pela qual os vírus não podem ser considerados seres vivos celulados (providos de células)?

Questão 28- Células vegetais, como as representadas na figura A, foram colocadas em uma determinada solução e, no fim do experimento, tinham aspecto semelhante ao da figura B.





De acordo com a situação, induza sobre as concentrações de solutos dentro e fora da célula. Como se denomina o tipo de transporte realizado pela célula acima? Por que a parede celular não se deformou?

Questão 29 - Um peixe tipicamente marinho é introduzido em um tanque contendo água doce. Analisando o balanço osmótico, o que ocorrerá com o corpo e estruturas orgânicas deste peixe?

Questão 30- Certos tipos de moléculas atravessam isoladamente a membrana plasmática e penetram no citoplasma. Também existem processos nos quais grandes quantidades de material passa para o interior da célula. Estes dois processos têm a mesma natureza de transporte? Como se denomina o transporte na primeira e segunda situação.

Questão 31- Três funis, contendo substâncias diferentes, porém em mesmas quantidades, foram colocados em um recipiente com uma determinada solução. Após algum tempo, o nível das substâncias no interior dos funis mostrava-se como no esquema abaixo:



Com base nestes dados, qual é a concentração de solutos na solução de referência?

Questão 32- Batatas, antes de serem fritas, são imersas em água com sal durante alguns minutos e depois escorridas em papel absorvente. Além de realçar o sabor, qual o efeito biológico acarretado por essa providência? Sobre esta situação e conhecimentos correlatos, julgue os itens abaixo, justificando os itens errados.

(1). As batatas amolecem tornando-se mais fáceis de mastigar.
(2). A água com sal hidrata o alimento tornando-o mais volumoso.
(3). A água lava o alimento e elimina as bactérias alojadas nas células.
(4). As batatas perdem água, fritam melhor e tornam-se mais crocantes.
(5). A água acelera os processos mitóticos, aumentando a massa das batatas.

Questão 33- É prática comum temperarmos a salada com sal, pimenta-do-reino, vinagre e azeite. Porém, depois de algum tempo, observamos que as folhas vão murchando. Como tal fato é explicado segundo a ciência da citologia?

Questão 34- O citoplasma de uma célula eucariótica está compreendido no espaço entre as membranas nuclear e citoplasmática. Sobre esse componente celular, julgue os itens abaixo, corrigindo o texto dos itens errados segundo as bases conceituais da biologia celular.

(1). É uma mistura complexa de substâncias orgânicas e inorgânicas.
(2). Ao microscópio eletrônico, apresenta-se heterogêneo.
(3). Existem, em seu interior, várias organelas que desempenham funções definidas.
(4). Pode-se observar facilmente o seu movimento de ciclose em células vegetais.
(5). Todas as organelas citoplasmáticas são comuns a todas as células de todos os grupos de seres vivos.
(6). Não apresenta microtúbulos em seu interior.

Questão 35- Esquematize uma célula eucariótica e procariótica, denominando suas estruturas internas e de fronteira. Faça um resumo sobre a função de cada um dos organóides descritos neste esquema.

Questão 36- Considere as seguintes estruturas celulares:
I- retículo endoplasmático.
II- complexo de Golgi.
III- grânulos de secreção.

A seqüência de estruturas em que seria encontrado um aminoácido radioativo, desde a entrada até sua saída da célula, é, respectivamente:
a) III, II, I
b) II, I , III
c) III, I, II
d) I, II, III
e) II, III, I
Justifique sua resposta com base em conhecimentos consolidados sobre a síntese protéica.


Questão 37- Os grânulos que, ao microscópio eletrônico, são vistos sobre o retículo endoplasmático são que tipo de organóide? Qual é a sua função? Tal atividade se equivale ao do mesmo organóide livre no citoplasma ou visto no interior da mitocôndria? Justifique sua resposta com base nas teorias vistas na citologia.

Questão 38- Uma célula animal que sintetiza, armazena e secreta enzimas, deverá ter bastante desenvolvidos ou em grande quantidade os organóides: mitocôndria, ribossomos, retículo endoplasmático granular e aparato golgiense. Qual é a razão funcional do metabolismo celular para ocorrer tal situação?

Questão 39 - Para que ocorra a digestão no interior de uma ameba, é necessário que os fagossomos fundam-se a que tipo de organóide? Qual é a origem deste organóide? Como é composto e qual é a sua função direta?

Questão 40- julgue os itens abaixo sobre a maneira como os seres vivos retiram a energia da glicose. Corrija os itens incorretos.

a) O organismo, como precisa de energia rapidamente e a todo tempo, faz a combustão da glicose em contato direto com o oxigênio.
b) Como a obtenção de energia não é sempre imediata, ela só é obtida quando a glicose reage com o oxigênio nas mitocôndrias.
c) A energia, por ser vital para a célula, é obtida antes mesmo de a glicose entrar nas mitocôndrias usando o oxigênio no citoplasma, com liberação de duas (02) moléculas de ATP (glicólise).
d) A energia da molécula de glicose é obtida através da oxidação dessa substância pela retirada de hidrogênios presos ao carbono (desidrogenações), que ocorre a nível de citoplasma e mitocôndrias.
e) A obtenção de moléculas de ATP é feita por enzimas chamadas desidrogenases (NAD) depois que a molécula de oxigênio quebra a glicose parcialmente no hialoplasma (glicólise).


ECOLOGIA

Questão 41- Defina ecossistema como nível de organização. Quais são os fatores bióticos e abióticos que definem um ecossistema/bioma?

Questão 42- Quais são os conceitos de HABITAT e NICHO ECOLÓGICO? Julgue os itens abaixo como certos e errados, justificando sua resposta segundo os conceitos trabalhados
(1). cobra e gavião ocupam o mesmo habitat.
(2). preá e cobra estão no mesmo nicho ecológico.
(3). gavião, cobra e preá estão no mesmo nicho ecológico.
(4). cobras neste mesmo local ocupam o mesmo nicho ecológico.
(5). preás podem ocupar o mesmo habitat, mas têm nichos ecológicos diferentes.

Questão 43- O ambiente descrito, com inúmeros animais e vegetais, à beira de um charco de água doce que, durante o dia, sofre flutuações de temperatura, luminosidade, maior ou menor pH e até alterações de salinidade, poderá ser classificado como um exemplo de:

a) biosfera
b) Pirâmide ecológica
c) biomassa
d) ecótone
e) ecossistema
Justifique sua resposta indicando a razão pela qual não marcou os itens que considerou errados.

Questão 44- Suponha que em um terreno coberto de capim gordura vivem saúvas, gafanhotos, pardais, preás e ratos-do-campo. Nesta região estão presentes quantas populações? Pode-se considerar a descrição deste texto como comunidade ou ecossistema? Justifique suas respostas com base nos conceitos organizacionais vistos na primeira parte deste estudo dirigido.

Questão 45 - Suponha duas plantas pertencentes ao mesmo gênero e vivendo juntas na mesma área. A espécie A tem raízes que se desenvolvem logo abaixo da superfície e a espécie B tem raízes profundas. Sobre as duas plantas e as descrições podemos afirmar que estas ocupam o mesmo nicho? Estas plantas competem por insumos do solo? Justifique suas respostas com base nos conceitos de nicho e dinâmicas de comunidades.

Questão 46- Mergulhando em águas costeiras, encontramos em uma rocha algas, cracas, anêmonas, estrelas-do-mar e ouriços-do-mar. As algas produzem seu próprio alimento. As cracas ingerem, com água, seres microscópios que nela vivem. As anêmonas comem pequenos peixes que ficam presos entre seus tentáculos. As estrelas-do-mar prendem seus “braços” os moluscos contra a rocha e sugam o animal de dentro da rocha. Os ouriços do mar raspam a rocha com seus “dentes”, alimentando-se de detritos. Em função do que foi descrito e de seus conhecimentos correlatos, esquematize uma teia alimentar diante os seres vivos desta situação. Quantas cadeias alimentares existem na teia esquematizada por você?

Questão 47- Quem são os principais produtores da cadeia biológica marinha? Por que se diz que tais seres são os principais produtores de oxigênio do planeta Terra e não as plantas terrestres?

Questão 48- Do texto abaixo, classifique os organismos dentro de um trofo da cadeia alimentar (produtor, consumidor primário, consumidor secundário, etc., decompositor)
“As espécies de capim que crescem nos campos da Austrália podem ser diferentes das que existem na América ou na África, mas todas têm a mesma função: são produtores dos ecossistemas de campo. Nos campos da Austrália vivem cangurus, nos da África há zebras e na América do Norte há bisões.”

Questão 49- Tendo em vista os conceitos de CADEIA e TEIA alimentar, bem como de POPULAÇÃO e COMUNIDADE, julgue os itens abaixo justificando os itens falsos com base nos conceitos ecológicos.
(1). A preá, a cobra e o gavião representam uma população e um exemplo de uma cadeia alimentar.
(2). O conjunto de preás da região forma uma população e os consumidores, entredevorando-se, formam uma teia alimentar.
(3). Preás e cobras do charco formam uma população e, para as cobras, as preás são produtoras de alimento.
(4). Preás, cobras e gaviões formam uma comunidade; as cobras são consumidores primários e os gaviões consumidores secundários.
(5). O conceito de produtor está associado ao fornecimento de alimento e, de consumidor, àqueles que o utilizam.
(6). A energia contida no produtor diminui gradualmente, ao passar de consumidor a consumidor.
(7). A energia do produtor aumenta gradualmente nos diferentes elementos da cadeia alimentar.
(8). O potencial energético do produtor não sofre nenhuma alteração nos diferentes segmentos da cadeia alimentar.
(9). Na cadeia alimentar, como os animais são de tamanho diferentes , a quantidade energética do produtor sofre oscilações.
(10). A complexidade da teia alimentar não interfere com a quantidade de energia transferida, que permanece inalterada.

Questão 50- Qual é o conceito de equilíbrio ecológico em relação ao número de indivíduos das populações de um ecossistema ao longo do tempo? Se uma ou mais destas populações tiverem seu número de indivíduos aumentados ou diminuídos demais em curto espaço de tempo, quais seriam as conseqüências diretas e indiretas nas outras populações conviventes?

Questão 51- Geralmente, nas pirâmides ecológicas, a base dos produtores é maior que o corpo e o pico piramidal correspondente aos consumidores. Qual é a razão desta disposição neste tipo gráfico (pirâmide) que expressa as relações quantitativas em um ecossistema? Pode haver a inversão desta pirâmide ecológica? Em que situações? Qual é a razão de ser impossível a inversão da pirâmide ecológica de energia?


Questão 52- Em um ecossistema, com a passagem de energia de um nível trófico para outro, esta sofre alteração quantitativa? Por quê?

Questão 53- Há 3 tipos de pirâmides ecológicas. Quais são estas? O que cada um dos tipos expressa em termos de quantidades em um ecossistema no que tange as relações entre os seres de uma comunidade?

Questão 54- Um dos perigos da utilização de inseticidas clorados é que eles são muito estáveis e permanecem longo tempo nos ecossistemas. Em vista disso, dada a cadeia alimentar

capim inseto pássaro cobra gavião


é de esperar que a maior concentração de DDT por quilo de organismo seja encontrada em qual trofo? Jusfique sua resposta com base na teoria de bioacumulação.


Questão 55- julgue as afirmativas abaixo corrigindo os textos incorretos

I. A energia introduzida no ecossistema sob a forma de luz é transformada, passando de organismo para organismo sob a forma de energia química,
lI. No fluxo energético, há perda de energia em cada elo da cadeia alimentar.
III. A transferência de energia na cadeia alimentar é unidirecional, tendo início pela ação dos decompositores.
IV. A energia química armazenada nos compostos orgânicos dos seus produtores é transferida para os demais componentes da cadeia e permanece estável.

Questão 56- “Em dois hectares de terra, foram plantadas 3.600 mudas de eucalipto sem ocorrer a retirada da vegetação nativa. Tal procedimento foi interpretada como uma ação com base em desenvolvimento sustentável”. Com base em conceitos ecológicos você concorda com tal procedimento como sendo um ato de desenvolvimento sustentável? Justifique sua resposta com base nos impactos ambientais sobre este ecossistema.

Questão 57- O tucunaré, peixe trazido da Amazônia para as lagoas de captação das usinas estabelecidas ou em construção nos rios Paraná, Tietê e Grande, adaptou-se às condições locais e serviu como elemento de controle das populações de piranhas que ameaçavam proliferar nos reservatórios das usinas hidrelétricas de Minas Gerais e São Paulo já que o primeiro se alimenta dos alevinos da segunda população além dos peixes adultos da mesma população ocuparem nichos semelhantes. O mesmo tucunaré terá sua criação incrementada na barragem de Itaipu, afastando o perigo do domínio das águas do Rio Paraná por cardumes de piranhas. Como se denomina tal procedimento de controle de populações? Qual é a relação ecológica entre o tucunaré e as piranhas? No caso de uma eliminação da população de piranhas, qual seria a conseqüência as outras populações deste ambiente aquático.

Questão 58- Considere uma cadeia alimentar constituída por fitoplâncton, peixes herbívoros e peixes carnívoros. O que acontece com as outras populações imediatamente após redução drástica dos peixes carnívoros?

Questão 59- Apesar de quase 4/5 da atmosfera serem constituídos de nitrogênio, apenas alguns seres têm a capacidade de aproveitar o nitrogênio em forma elementar para o seu metabolismo. Quais são os organismos capazes de fixar o nitrogênio do ar no solo? Qual é a substância produzida por estes organismos a partir do nitrogênio atmosférico? O que ocorre com esta substância produto sob a ação de outros organismos do solo capazes de metabolizar o nitrogênio molecular? Qual é o papel das plantas neste ciclo biogeoquímico que permite o acesso de substâncias nitrogenadas vitais a todos os seres vivos? Como o nitrogênio é devolvido para a atmosfera?

Questão 60- Uma forma natural de aumentar a quantidade de nitrogênio, disponível no solo sob a forma de nitratos, é alterar o cultivo de plantas não leguminosas com leguminosas, pois as últimas apresentam, nas suas raízes, módulos com bactérias capazes de fixar o nitrogênio atmosférico. Como se denomina este grupo de bactéria? Dê um exemplo de culturas agrícolas que poderiam ser utilizadas na rotação de cultura descrita acima.

Questão 61- É preocupação dos ecólogos o fato de que as calotas polares podem vir a sofrer um processo de descongelamento, em virtude de um aquecimento da atmosfera terrestre. Esse aquecimento, conseqüência de um desequilíbrio ecológico, decorre de quais ações humanas? Qual é o ciclo biogeoquímico relacionado ao aquecimento da atmosfera?

Questão 62- Esquematize o ciclo do carbono explicitando os fatores de emissão de carbono a atmosfera e o principal fator de fixação deste carbono para os seres vivos. Como o conceito de cadeia alimentar é inserido neste ciclo biogeoquímico?

Questão 63- Qual é o processo vital presente nos ciclos do oxigênio, do carbono e da água? Descreva a reação química que justifica sua resposta.

Questão 64- Suponhamos que o charco onde viva um preá e os outros seres vivos, com o decorrer dos tempos, vá lentamente se modificando. O espelho d’água diminua, pela progressiva invasão de novas plantas, assoreamento e a instalação de plantas mais duradouras; pelo surgimento de novos animais e desaparecimento de outros. O cenário se modifica. Como se denomina esse fenômeno? Esta descrição é uma forma primária ou secundária deste fenômeno ecológico? Justifique sua resposta com base em conceitos de dinâmica de comunidades.


Questão 65- Numa sucessão ecológica de comunidades, o que ocorre com a biomassa, diversidade e produtividade primária ao longo do processo? Como se denomina as fases da sucessão ecológicas com populações pioneiras, intermediárias e as mais diversificadas?

Questão 66- Descreva pelo menos 3 características vistas no bioma do cerrado em relação ao;

(a) Clima

(b) Solo

(c) Vegetação

(e) Distribuição de água na superfície

(f) Fauna

Questão 67- Quais são as outras duas formações savânicas no mundo semelhantes ao cerrado brasileiro? Qual é a explicação para lugares tão distintos, em continentes diferentes, possuírem biomas tão semelhantes?

Questão 68- Onde se localiza o cerrado brasileiro? É correto afirmar que o cerrado brasileiro é o ecossistema com o maior número de Ecótonos (ecótenes) do planeta Terra? Por que? Qual é a consequência deste fator para a biodiversidade do cerrado?
Questão 69 - Em relação a vegetação típica do cerrado (principalmente a observada no cerrado Stricto Sensu ), caracterize e estabeleça a justificativa evolutiva para tal característica em relação as;


(a) Folhas EX: Epiderme grossa e rígida, caduncas, podem apresentar anexos pelíferos - tais fatores evitam o excesso de transpiraçã e perda de água, principalmente na época da seca.
(b) Casca do tronco
(c) Raíz
(d) Tronco
(e) Sementes (ativação pró germinação na dormência)

Questão 70- Defina o que é Escleromorfismo Oligotrófico, fenômeno típico da vegetação no cerrado? Qual é a relação de tal fenômeno com a deficiência de água na superfície imediata do solo? E com as características minerais destes solo?

Questão 71 - Por que o solo do cerrado é ácido? Quais são os fatores que contribuem com tal acidez? Como tal fator influencia a fisiologia celular e sistêmica das plantas no cerrado?

Questão 72- O que é calagem (procedimento realizado no solo do cerrado) para que serve? Existe algum processo de calagem natural, como ocorre tal fenômeno e como este influencia a disposição da vegetação no cerrado?

Questão 73 - Usando argumentação de padrões de solo, distribuição e presença de água, equilíbrio entre padrões de vegetação (gramíneas, arbustivas e arbóreas) e outros fatores; caracterize as principais formações do cerrado correlacionadas abaixo;

(a) Campo limpo
(b) Campo sujo
(c) Campo rupestre
(d) Cerrado Stricto Sensu
(e) Cerrado Ralo
(f) Cerrado típico
(g) Cerradão
(f) Floresta ou mata de Galeria
(g) Floresta ou mata Ciliar
(h) Veredas

Questão 74 - Das formações observadas na questão anterior, quais são caracterizadas como;

(a) Formações Campestres ou cerradinho

(b) Formações savânicas

(c) Formações florestais

Qual é o predomínio de vegetação em cada uma destas formações no que tange a espécies gramíneas, arbustivas e arbóreas?

Questão 75- Como o fogo, na forma de incêndios ocasionais na época da seca, são importantes ao ecossistema do cerrado? Com base na leitura do livro, descreva pelo menos 4 fatores positivos do fogo sobre a manutenção das características do cerrado brasileiro.

Questão 76- Por que incêndios de grande proporção, geralmente de origem criminosas, não levam aos mesmos benefícios dos incêndios descritos na questão anterior? Quais são as razões de incêndios crimosos nas regiões de cerrado brasileiro?

segunda-feira, 19 de novembro de 2007

Estudo Dirigido Para a Prova do 4º Período 2007 - 8º ano - Ensino Fundamental

Finalizantes alunos;

Mais um estudo dirigido para a reta final de estudos.

Um grande abraço e ótimas férias.

Prof. Augusto César Willer


Estudo Dirigido - 4º período de 2007
(para o 8º ano do Ensino Fundamental)
Questão 01 - Esquematize dois neurônios conectados denominando e localizando as seguintes estruturas:
* Corpo Celular
* Dendritos
* Axônio
* Barra ou estrato mielínico
* Núcleo celular
* Vesículas pré-sinapticas
* Vesículas pós-sinápticas
* Fenda sináptica
Questão 02- Como se subdivide o sistema nervoso? Quais são os órgãos que constituem o sistema nervoso central (SNC)? Quais os órgãos que constituem o sistema nervoso periférico (SNP)?
Questão 03- Descreva duas funções, no mínimo, desempenhadas pelos órgãos que constituem o SNC:
(a) Cérebro
(b) Cerebelo
(c) Ponte
(d) Bulbo
(e) Medula espinhal
Questão 04 - Como se subdivide o sistema nervoso autônomo? Como estas partes do sistema atuam em um órgão onde estes agem? Cite 3 exemplos de ação do sistema nervoso autônomo simpático e parassimpático sobre órgãos distintos.
Questão 05 - Descreva 6 processos que ocorrem no organismo humano sob ação do hormônio adrenalina associado ao sistema nervoso autônomo? Em que situações a adrenalina e lançada na corrente sanguínea? Qual o órgão (glândula) que produz a adrenalina?
Questão 06- Sobre as anomalias mais comuns verificadas na visão humana responda;
(a) Miopia
a1- Onde se forma a imagem dentro do globo ocular ou do sitema visual?
a2- Qual é a forma do globo ocular em relação ao olho normal (sem anomalias)? Desenhe se for necessário para ilustrar a resposta.
a3- Como se comporta o cristalino em um indivíduo com tal anomalia na tentativa de focar de forma nítida a imagem?
a4- Como se denomina a lente que corrige tal anomalia? Como esta lente age no processo de correção?
(b) Hipermetropia

b1- Onde se forma a imagem dentro do globo ocular ou do sitema visual?
b2- Qual é a forma do globo ocular em relação ao olho normal (sem anomalias)? Desenhe se for necessário para ilustrar a resposta.
b3- Como se comporta o cristalino em um indivíduo com tal anomalia na tentativa de focar de forma nítida a imagem?
b4- Como se denomina a lente que corrige tal anomalia? Como esta lente age no processo de correção?
(c) Astigmatismo
c1- Onde se forma a imagem dentro do globo ocular ou do sitema visual?
c2- Qual é a forma do globo ocular em relação ao olho normal (sem anomalias)? Desenhe se for necessário para ilustrar a resposta.
c3- Como se comporta o cristalino em um indivíduo com tal anomalia na tentativa de focar de forma nítida a imagem?
c4- Como se denomina a lente que corrige tal anomalia? Como esta lente age no processo de correção?
Questão 07- Esquematize denominando as estruturas do ouvido ou orelha externa, média e interna? Qual é a função do pavilhão auditivo (orelha externa)? Qual é a função da cêra formada na orelha ou ouvido médio? Como ocorre a fisiologia (funcionamento) do tímpano e ossículos (estribo, bigorna e martelo) quando recebem uma vibração sonora? Qual é a relação entre a cóclea (caracol da orelha interna) e o nervo ótico (cuidado ótico é o nervo da audição, óptico é o da visão!)?
Questão 08 - Qual é a função do labirito (órgão da orelha interna) e o sistema de equilíbrio , controle de pressão interna em relação a pressão externa e processo de localização espacial?
Questão 09- Em que região da pele localiza-se as terminações nervosas responsáveis pelo tato? Cite 5 tipos de sensações atribuidas ao sentido do tato.
Questão 10 - Cite 5 glândulas exócrinas descrevendo onde estas se localizam e qual é o tipo de secreção/excreção produzidas por estas. Qual é a (são) a(s) função(ões) de cada uma destas secreções/excreções por você escolhida.
Questão 11- Por que a sensação de gustação e olfato tem uma origem de estímulo químico? Por que a gripe, alergias respiratórias e resfriados prejudicam a sensação de gustação mesmo estando as secreções obstruíndo especificamente a região da mucosa nasal?
Questão 12 - Em que regiões da coluna vertebral ocorrem os traumas que levam a;
(a) Morte por insuficiência respiratória e cardíaca?
(b) Tetrplegia
(c) Paraplegia total
(d) Paraplegia parcial
Questão 13 - Quais são os ossos que protegem o sistema nervoso central?
Questão 14 - O que é uma glândula endócrina? O que é hormônio? O que a difere de uma glândula exócrina em relação ao tipo de secreção e ao local de emissão deste material por ela produzido? Em relação as glândulas endócrinas abaixo citadas, descreva a denominação do(s) hormônio(s) produzido(s), função(ões) deste(s) hormônio(s), em que órgãos e/ou tecidos agem, como se denomina a doença causada pelo mal funcionamento desta glândula e uma breve descrição desta patolologia.
(a) Hipófise
(b) Tireóide
(c) Paratireóide
(d) Pâncreas endócrino
(e) Ovário
(f) Testículos
(g) Supra renal
Questão 15- "O sistema nervoso e endócrino funcionam em harmonia com o objetivo de manter a homeostase e a adaptação e percepção do meio pelo indivíduo". Em relação a sentença acima responda;
(a) Qual é a região do SNC e a glândula responsável pela interconexão dos dois sistemas?
(b) Qual é o sistema que verdadeiramente comanda o organismo? Justifique sua resposta com base na fisiologia do organismo humano.

domingo, 18 de novembro de 2007

Conteúdo à recuperação anual – 1º ano do Ensino Médio 2007


Introdução a biologia

Níveis de Organização Definições e alvo de estudo de moléculas, organóides, células, tecido, órgão, sistema, organismo, espécie/população, comunidade, ecossistema e biosfera. Capítulo 02


Bioquímica


Componentes da matéria viva: Substâncias orgânicas e inorgânicas. Funções das substâncias orgânicas. Capítulo 03

A água nos seres vivos e na natureza Capítulo 03

Ácidos nucléicos: Estrutura, funções e diferenças entro o DNA e o RNA. Capítulo 04 e 07


Biologia Celular

A membrana celular: Estrutura básica da membrana (composição lipoprotéica e modelo do mosaico-fluido). Parede celular: composição, função e em que células são encontradas. Capítulo 05


Organóides citoplasmáticos: ribossomos, retículo endoplasmático agranular (liso), retículo endoplasmático granular (rugoso), aparelho ou aparato golgiense, lisossomos, peroxissomos, mitocôndrias, cloroplasto, citoesqueleto, centríolos. Capítulo 06


Núcleo: estrutura (carioteca e nucleoplama), cromatina (cromonemas) e cromossomos. Divisão celular mitótica e sua importância para os unicelulares e pluricelulares, mitose e câncer, divisão celular meiótica e sua importância. Capítulo 07, 08 e 09



Ecologia


Cadeias e teias alimentares: diferença entre estes conceitos, capacidade de verificar e identificar exemplos de cadeias e teias alimentares. Capítulo 57

Ciclos biogeoquímicos: Ciclo da água, ciclo do carbono, ciclo do oxigênio e ciclo do nitrogênio Capítulo 57

Dinâmica de comunidade: Relações ecológicas harmônicas e desarmônicas; relações ecológicas intra-específicas e interespecíficas. Gráficos de descrição de relações de mutualismo, competição e predatismo. Capítulo 59

Sucessão ecológica primária e secundária: fase de Ecese (pioneiras), sere (intermediárias) e clímax. Comparação das fases através da produtividade primária bruta, produtividade primária líquida, biodiversidade e biomassa. Capítulo 59

Poluição e desequilíbrio ecológico: Poluições do ar e suas conseqüências (efeito estufa, chuva ácida e buraco na camada de ozônio); poluições das águas (processos de eutrofização); poluições de solo (lixiviação, assoreamento e desertificação); poluições urbanas (inversão térmica e lixões); causas de modificações de números populacionais (extinção e proliferação de espécies) e conseqüente desequilíbrio ecológico. Capítulo 61

O cerrado brasileiro: características gerais do cerrado brasileiro (solo, clima, padrão de vegetação, disponibilidade de água); formações de fitofisionomias do cerrado (campestres, savânicas e florestais); a biodiversidade no cerrado; definição de ecótonos vistos no cerrado; fenômenos de incêndios no cerrado; a problemática da ocupação humana no cerrado (pecuária, agricultura e urbanização). Desenvolvimento sustentável. Capítulo 60 (pág. 869) e Livro paradidático- O cerrado Brasileiro

domingo, 11 de novembro de 2007

Placenta age como um parasita para proteger feto, diz estudo




da BBC Brasil


Cientistas britânicos descobriram que a placenta age como um parasita para evitar ataques do sistema imunológico da mãe.
A equipe da Universidade de Reading identificou que a placenta tem um mecanismo de dissimulação muito semelhante ao usado por lombrigas parasitas para se proteger dos ataques do sistema imunológico do indivíduo que o hospeda.
A placenta desempenha um papel vital na gestação, porque age como um elo entre a mulher e o feto, fornecendo a ele os nutrientes essenciais ao seu desenvolvimento.
Contudo, como tanto a placenta como o feto têm uma composição genética diferente da mãe, em tese eles estão vulneráveis a um ataque do sistema imunológico materno.
Os pesquisadores já sabiam que a placenta secretava uma proteína chamada neuroquinina (NKB).
No entanto, foi apenas durante as pesquisas em laboratório que a equipe descobriu que a NKB continha a molécula fosfocolina, que é usada pelo parasita nematóide para desarmar o sistema de defesa do seu hospedeiro.
Os cientistas da Universidade de Reading esperam que a descoberta ajude a explicar por que algumas mulheres sofrem abortos recorrentes e condições que oferecem grande risco na gestação como a pré-eclampsia.
Além disso, eles acreditam que aprender a imitar o método adotado naturalmente pela placenta para evitar a rejeição pelo sistema imunológico possa levar a avanços no tratamento de outras doenças, como a artrite.
"Criar um mecanismo pelo qual você pode tornar as células invisíveis ao sistema imunológico pode levar a curas de uma série de doenças e condições", disse um dos cientistas envolvidos na pesquisa, Phil Lowry.

sexta-feira, 2 de novembro de 2007

Caros alunos;

Para aqueles que buscam uma interessante literatura para ler antes da prova do PAS, segue abaixo uma agradável leitura que será útil as matérias de biologia, química e visão de atualidades para as 3 etapas






Autor: Marcelo Leite


Editora: PublifolhaPáginas: 104


Quanto: R$ 17,90


Onde comprar: nas principais livrarias, pelo telefone 0800-140090 ou pelo site da Publifolha




A seguir segue a introdução do livro que dá a idéia das teses vistas na literatura.




O DNA, consagrada abreviação em língua inglesa da substância ácido desoxirribonucléico, representa provavelmente a molécula1 mais famosa do mundo. Talvez apenas a fórmula H2O seja mais conhecida, mas poucas pessoas que não sejam químicos de formação saberão descrever a forma tridimensional da molécula da água (na sua forma gasosa, os dois átomos de hidrogênio, H, formam um ângulo de 105°, tendo no vértice o de oxigênio, O). Menos gente ainda, decerto, deixará de ter visto e memorizado a estrutura de escada de pintor torcida do DNA, tradicionalmente descrita como "dupla hélice". Ela se tornou um ícone do final do século 20, sobretudo depois que o consórcio internacional Projeto Genoma Humano e a empresa norte-americana Celera soletraram, no ano 2000, a maioria dos caracteres químicos que constituem os quase 3 bilhões de degraus das longuíssimas cadeias de DNA nos 23 pares de cromossomos da espécie humana. Essa é a imagem por excelência da ciência natural nos dias de hoje, como foi na década de 50 o desenho esquemático do átomo (simbolizando a não menos temível energia nuclear). A cada oportunidade em que algum tema de genética ou biotecnologia alcança a ordem do dia - e isso ocorre com freqüência cada vez maior -, lá está a dupla hélice a sinalizar um entrelaçamento de esperança e temor. Do genoma humano à clonagem de ovelhas e homens, da identificação de genes envolvidos no câncer à polêmica dos alimentos transgênicos, dos testes de paternidade às discussões sobre o sempre presente fantasma da eugenia, pode-se contar que a figura do DNA aparecerá associada, seja na vinheta da TV, seja na capa do livro, seja na ilustração do jornal - seja até em anúncios de xampu e de gasolina, nesses dois casos como sinônimo de eficácia molecular e de autenticidade.Complexidade vs. DeterminismoTal onipresença decorre não apenas da importância que as biotecnologias vêm assumindo para a medicina, mas também do impacto simbólico e cultural que o conhecimento da estrutura do DNA e as inovações que propiciou tiveram nas últimas cinco décadas, desde que o norte-americano James Watson e o britânico Francis Crick a decifraram, no famoso artigo para a revista científica Nature publicado no dia 25 de abril de 1953. Com a imodéstia que sempre lhe foi característica, Watson afirmou em suas memórias que esse fora "talvez o mais famoso evento em biologia desde o livro de Darwin". E não sem motivo: ficar sabendo que em cada uma das células do próprio corpo (10 trilhões delas, distribuídas em cerca de mil tipos diferenciados) há um conjunto virtualmente idêntico de 6 bilhões de letras químicas estreitamente associadas com as características mais pessoais é uma dessas revelações marcantes do conhecimento, como a descoberta de que a Terra, vista do espaço, é um planeta azul - algo que hoje parece óbvio, mas que só foi confirmado pelos olhos do cosmonauta soviético Iúri Gagárin em 12 de abril de 1961. Afeta em sentido profundo o modo humano de compreender o mundo e os próprios homens, por vezes num sentido e numa proporção que extrapolam o próprio conteúdo objetivo e comprovado da descoberta científica, como no caso do problemático impulso dado ao determinismo genético pelo que há de impressionante nos avanços da biologia molecular.O desvendamento da intimidade da matéria viva cria uma promessa e uma ilusão de controle ou precisão que a tecnociência biológica ainda está longe de alcançar. Muita gente culta acredita piamente que a transcrição do genoma humano tem o poder de desvendar, por si, os mecanismos envolvidos em processos fisiológicos tão decisivos quanto câncer, envelhecimento e infecções, quando qualquer pessoa minimamente familiarizada com os rumos atuais da genômica sabe que a cada avanço nessa área corresponde igualmente um aumento de complexidade. Muitas vezes, compreender pode também significar que o controle almejado pelo saber é mais difícil do que se esperava, ou mesmo pouco provável. Um exemplo recente e eloqüente é o ainda mal compreendido fenômeno da interferência de RNA (RNAi, na abreviação em inglês com que se tornou mais conhecido), destacado pela prestigiada revista especializada norte-americana Science como o principal avanço da pesquisa científica no ano de 2002 e explicado a seguir.O pressuposto de toda a engenharia genética é que, ao modificar-se o DNA de um organismo incluindo em seu genoma um ou mais genes de seqüência conhecida (ou, numa estratégia diversa, silenciando genes para que o organismo pare de sintetizar certas substâncias), a planta ou animal passará a produzir (ou deixar de produzir) as proteínas correspondentes. É o que se faz com plantas transgênicas, por exemplo, incluindo nelas trechos de DNA extraídos de bactérias para que seu metabolismo passe a tolerar um herbicida (caso da soja Roundup Ready, da empresa Monsanto, resistente ao agrotóxico Roundup, o glifosato) ou passe a fabricar um inseticida nos seus próprios tecidos (caso do milho Starlink, da Aventis CropScience, que secreta a proteína inseticida Cry9C para aniquilar lagartas de borboletas e mariposas que se alimentam da planta). Mas nem sempre são esses os efeitos obtidos.Em alguns casos, cessa por completo a produção das substâncias pretendidas. Isso deixava os pesquisadores desconcertados até o começo dos anos 1990, quando se descobriu que pequenos trechos de RNA podiam modular a expressão (leitura) de genes pela maquinaria bioquímica das células. A prova definitiva dessa forma de interferência genética (daí o nome "interferência de RNA") veio em 1998, quando pesquisadores dos Estados Unidos - Andrew Fire (Carnegie Institution) e Craig Mello (University of Massachusetts Medical School) - enxertaram fitas duplas de RNA num tipo de verme e demonstraram que elas bloqueavam a expressão dos genes que continham justamente trechos de DNA coincidentes com as seqüências de RNA enxertadas. O mesmo fenômeno da RNAi foi posteriormente observado em insetos e outros organismos, provando a participação do RNA no que se convencionou chamar de silenciamento de genes.A interferência de RNA poderia ter-se transformado numa nota de rodapé da biologia molecu-lar, mera excentricidade bioquímica na já furiosa complexidade do metabolismo celular, não fossem indicações crescentes de que o mecanismo talvez seja universal entre organismos superiores, como animais e plantas. Ele teria sido herdado de ancestrais bacterianos, que o teriam desenvolvido há centenas de milhões de anos para proteger-se do ataque de vírus (desarmando os ácidos nucléicos que estes injetam na vítima para obrigá-la a produzir quantidades industriais de cópias do próprio vírus). Além disso, pode-se interpretar a RNAi como uma das mais flagrantes contradições de um pilar da biologia molecular, o Dogma Central formulado por Francis Crick em 1957: o fluxo de informação só se faz no sentido DNA ' RNA ' proteína, nunca no inverso (como ressalvou Sandro de Souza, tal dogma já vinha perdendo muito de seu peso desde os anos 1980, quando começaram a ser identificadas formas quimicamente ativas de RNA e continuou a desfazer-se a noção de que ele fosse mero intermediário entre DNA e proteínas).Ora, se o RNA pode silenciar genes (DNA), não é descabido dizer que o fluxo de informação se inverte. De um ponto de vista utilitário (e certamente é dessa perspectiva que flui o entusiasmo dos pesquisadores), isso significa também que toda uma nova classe promissora de ferramentas se apresenta para os biotecnólogos, pois eles talvez não precisem mais modificar o genoma - isto é, o DNA contido nos cromossomos - de um organismo para obter os resultados pretendidos, seja a resistência a um herbicida numa planta comercial, seja o tratamento de uma enfermidade humana. Em princípio, os mesmos efeitos poderiam ser alcançados sem reformar o "código da vida" no núcleo celular, bastando adicionar pequenos RNA ao seu citoplasma (o "recheio" das células). Não seria ainda, decerto, o desabamento do edifício da engenharia genética, lenta e arduamente erguido nas últimas três décadas, mas representaria no mínimo uma mudança radical de sua planta, com a adição de andares imprevistos a um prédio térreo, que mereceria - quem sabe? - ser relançado com o nome de "engenharia biomolecular".Genômica em baixaNo momento em que este volume chega às livrarias, em março de 2003, o anúncio pomposo da decifração do tal "código da vida" feito pelo então presidente norte-americano Bill Clinton e pelo premiê britânico Tony Blair, em 2000, está para completar três anos - sem que nem um único medicamento desenvolvido diretamente com base em informações divulgadas naquele dia, e em artigos científicos sete meses depois, tenha sido lançado no mercado. Uma das estrelas da cerimônia de 26 de junho na Casa Branca, o dublê de cientista e empresário Craig Venter, cuja empresa Celera forçara o concorrente Projeto Genoma Humano a antecipar em quase três anos a transcrição dos cromossomos da espécie, vem desde então perdendo prestígio - pelo menos no mundo das expectativas comerciais e financeiras da biotecnologia aplicada à medicina. Em 23 de janeiro de 2002, Venter deixou a presidência da Celera, que reverteu suas linhas de atuação para métodos mais tradicionais de desenvolvimento de remédios, uma vez que não estava decolando a tentativa de fazê-lo com base nas informações genômicas produzidas no atacado por Venter. Os genes seguramente contêm muitos detalhes relevantes para entender a espécie humana, mas não revelaram ainda o mapa dos lucros bilionários que as gigantes farmacêuticas buscam.A complexidade dos genes é tanta, e tão galopante (a julgar pelos resultados das pesquisas mais recentes, como a da RNAi), que não seria exagero dizer que a própria unidade operacional do conceito se encontra ameaçada, o que não impede muitas pessoas de continuar acreditando que genes equivalem a uma espécie de destino, e um destino que seres humanos se acreditam capazes de modificar com as ferramentas da engenharia genética. O propósito deste livro é mostrar que tal crença é correta e, ao mesmo tempo, despropositada, uma vez que a engenharia genética tem, sim, meios de produzir efeitos espantosos sobre seres vivos, mas que nem por isso se encontra na posição de ditar-lhes metabolismo e comportamento absolutamente previsíveis e controlados.Para chegar a esse objetivo, o primeiro passo é entender a estrutura da molécula de DNA, a famosa dupla hélice, explicada no capítulo 1. A função desse primeiro texto é tornar claro como a arquitetura da molécula encarna de forma elegante a realização de duas funções biológicas primordiais: primeiro, for-necer um molde para a fabricação de milhares de proteínas cuja ação concertada resulta na vida de um indivíduo de determinada espécie; depois, garantir que a geração seguinte receba um pacote mínimo de moldes para a continuação da espécie (ainda que comportando alguma variação, sem a qual a seleção natural não pode agir). Esse mesmo capítulo 1 buscará ainda elucidar, sem muita minúcia bioquímica, as engrenagens da máquina celular para duplicar o DNA (quando a célula se divide) e para ler sua seqüência (quando sintetiza as proteínas de que necessita).Os dois capítulos seguintes (2 e 3) possuem uma característica mais histórica, resumindo a longa e tortuosa trajetória entre as conjeturas de Gregor Mendel sobre a hereditariedade, na segunda metade do século 19, quando a palavra "gene" nem mesmo existia, e a plena compreensão das relações da seqüência de ácidos nucléicos (DNA e RNA) com o que há de específico em cada proteína. Entre uma coisa e outra, foi preciso provar que a substância da hereditariedade era o DNA, e não uma proteína, façanha nem sempre lembrada de Oswald Avery, em 1944. Depois, desvendar a organização bioquímica tridimensional do ácido, o feito muito mais famoso dos então obscuros Watson e Crick, em 1953, que derrotaram na corrida ninguém menos que Linus Pauling. O evento, que agora completa meio século, foi seguido de quase uma década de esforços para decifrar a relação entre essa estrutura e a das proteínas, capitaneados por Crick e pelo físico russo-americano George Gamow, ambos batidos na disputa pelo desconhecido Marshall Nirenberg, que corria por fora.Na Conclusão, serão retomadas algumas descobertas e refinamentos da pesquisa genômica que, assim como a interferência de RNA, estão reformulando a visão dos genes e do papel do DNA. Serão também oferecidas algumas indicações sobre o que se pode e deve esperar das biotecnologias, à luz - ou na penumbra - da complexidade assim revelada. Espera-se com isso que este pequeno volume se torne uma contribuição para que mais admiradores da biologia, molecular ou não, venham a perceber quanta sabedoria há na frase do geneticista de populações norte-americano Richard Lewontin, um crítico precoce e incansável da megalomania genômica: "Nossa biologia fez de nós criaturas que estão constantemente recriando seu ambiente psíquico e material, e cujas vidas individuais são os resultados de uma extraordinária multiplicidade de trajetórias causais entrecruzadas. Portanto, é a nossa biologia que nos torna livres".

terça-feira, 30 de outubro de 2007

Aula: Sistema Reprodutor, Métodos anticoncepcionais e DST's (1ª Etapa)


Atentos alunos;
Segue o link para a aula do sistema reprodutor


http://www.4shared.com/file/44334371/55a92fbd/Sexualidade_e_Gravidez_na_Adolescencia.html
2- Espere a página baixar totalmente (leva um tempinho)
3- Clique em Download file no meio da página
4- Salve ou abra o arquivo.
Abraços
Prof. Augusto César Willer

Aula do Sistema Endócrino


Esforçados alunos;


Segue o link para a aula do sistema endócrino


1 - Clique nos links abaixo;



2- Espere a página baixar totalmente (leva um tempinho)


3- Clique em Download file no meio da página


4- Salve ou abra o arquivo.

Abraços

Prof. Augusto César Willer

quarta-feira, 24 de outubro de 2007

Drogas

Aspectos Relevantes da Questão das Drogas

Conceito

Em todas as sociedades sempre existiram "drogas". Entendem-se assim produtos químicos ("psicotrópicos"ou"psicoativos"), de origem natural ou de laboratório, que produzem efeitos, sentidos como prazeirosos, sobre o sistema nervoso central. Estes efeitos resultam em alterações na mente, no corpo e na conduta.
Na verdade, os homens sempre tentaram modificar o humor, as percepções e sensações por meio de susbstâncias psicoativas, com finalidades religiosas ou culturais, curativas, relaxantes ou simplesmente prazeirosas.
Estudos têm demonstrado diferentes motivações para o uso de drogas: alívio da dor, busca de prazer e busca da transcedência são razões encontradas nos diversos grupos sociais ao longo da história.
Antigamente, tais usos fizeram parte de hábitos sociais e ajudaram a integrar as pessoas na comunidade, através de cerimônias, rituais e festividades. Hoje, tais costumes são esvaziados em conseqüência das grandes mudanças sócioeconômicas.
Características da modernidade, como a alta concentração urbana ou o poder dos meios de comunicação, modificaram profundamente as interações sociais. No decorrer desse processo o uso de drogas vem se intensificando.
Produtos antigos ou recentes, legais ou ilegais, conheceram novas formas de fabricação e comercialização, indo ao encontro de novas motivações e novas formas de procura. Hoje, diante da diversidade de produtos, é fundamental o conhecimento do padrão de consumo e efeitos das substâncias psicoativas, já que o uso e abuso de drogas representa uma questão social complexa.
Os fatores de risco para uso ou abuso de drogas
Quanto aos fatores de risco relacionados ao abuso de drogas, eles são maiores para certas pessoas, em função das suas condições de vida.
Assim, são mais inclinadas ao uso as pessoas:
· sem informações adequadas sobre drogas e seus efeitos;
· com uma saúde deficiente;
· insatisfeitas com sua qualidade de vida;
· com problemas psicológicos que possam torná-las vulneráveis ao abuso de drogas;
· com fácil acesso a drogas.
Problemas relacionados ao uso de drogas surgem, de fato, de um encontro entre três fatores básicos. Operando juntos, eles provocam as rupturas acima mencionadas que podem levar à dependência. São eles:

· droga, o "produto" e seus efeitos;
· a pessoa, a personalidade e seus problemas pessoais;
· a sociedade, o contexto sócio-cultural e econômico, suas pressões e contradições.
O consumo de drogas não se deixa dissociar da procura de prazer: pode tornar-se problemático precisamente por ser prazeiroso. Este prazer pode resultar de sensações de bem-estar, ou euforia ("barato"), de força, poder, leveza ou serenidade, ou ainda, da ausência de dor ou de memória.
A procura de bem-estar e prazer é natural, fazendo parte da vida de todos; o problema consiste em querer buscá-los usando drogas.


Dependência


Quando se precisa de tais meios artificiais, significa que há algo errado consigo mesmo ou nas relações com os outros. Recorrer a produtos químicos continuadamente apresenta-se então como uma saída possível, como se elas fossem uma "poção mágica" contendo a "solução". Na falta do produto ao qual a pessoa se acostumou, ela é invadida por sensações ou "sintomas" penosos, indo de nervosismo, inquietação ou ansiedade ao impulso de obtê-lo de novo, a qualquer custo. Este estado chama-se dependência. O dependente de drogas deve ser considerado como um doente. Este necessita de ajuda e tratamento para entender as razões de seu abuso e iniciar sua reinserção social.
Distingue-se a dependência física da dependência psíquica.

Dependência física


A dependência física ocorre quando o organismo acostuma-se à presença do produto, sendo que a sua falta provoca
os sintomas da síndrome de abstinência (p.ex. delirium tremens, no alcoolismo). Enquadram-se produtos como o
álcool, a nicotina, os produtos derivados do ópio.

Dependência psíquica ou vício


A dependência psíquica instala-se quando a pessoa se acostuma a viver sob os efeitos de um produto psicoativo.
Ela é dominada então por um impulso, quase incontrolável, de se administrar a droga com freqüência, para não experimentar o mal-estar da falta, conhecido como "fissura".
Significa, portanto, o apego da pessoa àquele estado de bem-estar.
Diante da complexidade de diferenciar os dois tipos, a OMS recomenda hoje falar apenas dependência, caracterizada (ou não) pela síndrome de abstinência .
Escalada

Chama-se escalada a passagem de um consumo ocasional a um uso intenso ou contínuo (escalada quantitativa), ou ainda a mudança de um uso de produtos "leves" para outros considerados "pesados " (escalada qualitativa). É importante assinalar que o produto psicoativo pode criar dependência, em função do modo de usar, do contexto e da personalidade.
Assim, a evolução para a escalada não é nem automática nem irreversível.


Tolerância

Fala-se de tolerância quando o organismo reage à presença de uma substância psicoativa através de um processo de adaptação biológica. Ele o incorpora em seu funcionamento de modo a responder cada vez menos ao produto.
Logo, para obter os mesmos efeitos, é necessário aumentar a dosagem. Esta elevação, comparável à escalada quantitativa, aumenta os riscos de uma superdosagem ("overdose"), capaz de provocar morte súbita por parada respiratória ou cardíaca, como no abuso da cocaína, por exemplo.

Tipos de usuários de drogas
É útil distinguir vários tipos de usuários de drogas, segundo critérios científicos, para desfazer o preconceito de que todo usuário seja "viciado" ou "marginal". Assim, a UNESCO distingue quatro tipos:


experimentador: limita-se a experimentar uma ou várias drogas, em geral por curiosidade, sem dar continuidade ao uso;

usuário ocasional: utiliza uma ou várias substâncias, quando disponível ou em ambiente favorável, sem rupturas nas relações afetivas, sociais ou profissionais;

usuário habitual ou "funcional": faz uso freqüente, ainda que controlado, mas já se observam sinais de rupturas;


usuário dependente ou "disfuncional" (toxicômano, drogadito, dependente químico): vive pela droga e para a droga, descontroladamente, com rupturas em seus vínculos sociais, podendo haver marginalização e isolamento.


O uso de drogas, portanto, não leva automaticamente a estados de dependência. Passa-se ao abuso com a perda de controle sobre o uso, em conseqüência de certas dificuldades ou fatores de risco, que variam de pessoa para pessoa, do contexto social e familiar. A compreensão dessas dificuldades e dos fatores de risco é crucial na ajuda ao dependente de drogas.


Relebrando conceitos importantes;

Origem da palavra: droga vem da palavra droog (holandês antigo) que significa folha seca. Isto porque, antigamente, a maioria dos medicamentos era à base de vegetais.

Droga: qualquer substância que é capaz de modificar a função dos organismos vivos, resultando em mudanças fisiológicas ou de comportamento.
Droga psicotrópica: é aquela que atua sobre o cérebro, alterando de alguma forma o psiquismo.
Medicamento ou fármaco: é a droga que atuando em organismos vivos, provoca efeitos benéficos ou úteis.
Tóxico: é a droga que administrada em organismos vivos produz efeitos nocivos.
Estimulantes: são as drogas que aceleram o funcionamento do cérebro. Ex: Anfetaminas; Cocaína; Cafeína.

Depressores ou inibidoras: são drogas que diminuem a velocidade de funcionamento do cérebro. Ex: Álcool; Hipnóticos não barbitúricos; Barbitúricos; Ansiolíticos; Narcóticos; Solventes (inalantes); Opiáceos.

Perturbadores ou alucinógenas: são drogas que alteram o funcionamento do cérebro. Ex: Derivados indólicos , da maconha; LSD-25

Definições Importantes




Tolerância: ocorre quando é necessário um aumento da dose da droga para a obtenção do mesmo efeito inicial ou após uma mesma dose o efeito é menor.

Dependência: é uma síndrome bio-psico-social manifestada por um padrão de comportamento no qual a procura e uso da droga tem uma prioridade extrema sobre outros comportamentos anteriormente valorizados.


Síndrome de abstinência: é um conjunto de sinais e sintomas contrários aos da droga que ocorrem quando uma pessoa pára abruptamente de consumir a droga que utilizava constantemente e que o organismo já estava adaptado.

Delírio: compreensão e raciocínio errados da situação ou do ambiente(objetos e pessoas).

Alucinação: percepção sensorial( tátil, olfativa, auditiva, visual) falsa que ocorre na ausência de um estímulo concreto.

Ilusão: é uma confusão e uma distorção de percepções e estímulos.



Exercícios;
Questão 01- A cartilha de prevenção ao uso e ao abuso de drogas da Secretaria de Segurança Pública do DF aponta,
entre outros, os seguintes sinais do uso habitual de drogas por estudantes:
• o absenteísmo ou a evasão;
• piora das notas escolares;
• mudança de humor: euforia, depressão, hostilidade, supersensibilidade;
• uso de óculos escuros e colírios.
Com relação a esses sinais, julgue os itens que se seguem.
(1) As notas de estudantes que fazem uso habitual de drogas pioram, em parte, porque muitas drogas afetam a
memória e a capacidade de raciocínio.
(2) O uso de óculos escuros visa somente disfarçar a vermelhidão dos olhos.
(3) As mudanças de humor descritas revelam o uso de mais de uma droga pela mesma pessoa.
(4) A negligência na escola é um dos aspectos do desinteresse geral muitas vezes desenvolvido pelo usuário de drogas, que pode incluir também o afastamento das relações sociais e o desleixo na higiene pessoal.
Questão 02- O texto abaixo foi extraído de urna entrevista em que um estudante, em tratamento psiquiátrico devido
ao uso de anabolizantes, dá o seu depoimento acerca do uso desses medicamentos.
Pergunta (P) - Como você começou a usar anabolizantes?
Resposta (R) - Um professor da academia me falou a respeito, e eu comecei a usar aos 16 anos. Eu tinha 60 kg e
rapidamente ganhei 10 kg.
P - É comum o uso de anabolizantes nas academias?
R - Virou uma coisa normal. Realmente a pessoa tem um resultado rápido, mas são músculos falsos. Você pára de
tomar e volta ao normal.
P - Como você se sentia quando estava usando anabolizantes?
R - Minha auto-estima ia lá em cima. Ficava eufórico com os resultados da malhação. Mas como tempo fui ficando
muito agressivo e irritado com tudo. Cheguei a agredir minha mãe e minha namorada. Não tinha controle sobre mim
P - E quando parava? Como você se sentia?
R - Muito deprimido. Meu corpo não reagia sem anabolizantes. Eu não tinha vontade de fazer nada. É igual cocaína.
Pira. Eu tranquei a faculdade por um ano porque não conseguia fazer nada. Só pensava em tomar anabolizante e
malhar.
P-Você ainda sente vontade de tomar anabolizantes?
R - Eu sei que não estou livre disso ainda. Qualquer hora posso ter uma recaída. A vida inteira serei dependente. Hoje
faço tudo para ficar longe. Mudei de academia e faço tratamentos que são alternativas para não voltar.
Anabolizante leva à internação psiquiátrica. "Cotidiano", p. C4. In: Folha de S. Paulo, 29/10/2000 (com adaptações).
Com respeito ao assunto do texto acima, julgue os itens a seguir.
(1) Os anabolizantes são hormônios que alteram a capacidade de absorção de proteínas pelo organismo.
(2) Quando o tratamento com anabolizantes é interrompido, a musculatura volta ao normal porque seu
desenvolvimento está relacionado ao aumento temporário da quantidade de fibras musculares.
(3) Os anabolizantes podem tanto estimular quanto deprimir o sistema nervoso.
(4) A fúria, a euforia e a agressividade citadas no texto ocorrem devido a um aumento das fibras mielínicas, que conduzem mais rapidamente os estímulos nervosos.


Questão 03- O combate ao abuso de drogas psicotrópicas ou psicoativas tem recebido especial atenção dos serviços de saúde
e educação. Nos grandes centros urbanos, o uso de drogas tem sido freqüentemente associado à violência e a doenças sexualmente transmissíveis, como a AIDS. Segundo a cartilha de prevenção ao uso e abuso de drogas da Secretaria de Segurança Pública do DF, entre os sinais do uso habitual de drogas por estudantes estão a evasão escolar, a piora das notas escolares e a mudança de humor (euforia, depressão, hostilidade, supersensibilidade).
Em relação a esse assunto, julgue os itens e justifique os errados.
(1) Problemas relacionados ao abuso de drogas surgem de um encontro entre três fatores básicos que operam juntos: a droga (o “produto”e seus efeitos); a pessoa (a personalidade e seus problemas pessoais) e a sociedade (o contexto sócio-cultural e econômico, suas pressões e contradições).
(2) Toda dependência química é caracterizada pela necessidade psicológica de continuar a usar a droga, assim como pela tolerância e por sintomas característicos da síndrome de abstinência.
(3) Chama-se escalada à passagem de um consumo ocasional a um uso contínuo ou à mudança de um uso de produtos “leves” para outros considerados “pesados”.
(4) O uso prolongado de drogas psicoativas faz com que doses cada vez menores da droga sejam capazes de produzir o mesmo efeito.
(5) Qualquer uso de drogas psicoativas leva automaticamente a estados de dependência.
(6) O consumo de bebida alcoólica potencializa a ação da maconha e vice-versa.
(7) O uso compartilhado de seringa para injetar drogas é um comportamento de risco na transmissão do HIV.
(8) As notas de estudantes que fazem uso habitual de drogas pioram, em parte, porque muitas drogas afetam a memória e a capacidade de raciocínio.
(9) A negligência na escola é um dos aspectos do desinteresse geral muitas vezes desenvolvido pelo usuário de drogas, que pode incluir também o afastamento das relações sociais e o desleixo na higiene pessoal.
(10) As mudanças de humor descritas no texto revelam o uso de mais de uma droga pela mesma pessoa.

quinta-feira, 18 de outubro de 2007

Provável Gabarito da Prova Discursiva do 4º período de 2007 (1º ano do Ensino Médio)

Provável Gabarito da Prova Discursiva do 4º período de 2007
(1º ano do Ensino Médio)


Questão 01-


(A) Campo sujo (0,1 ponto)
(B) Campo limpo (0,1 ponto)
(C) Campo de Vereda (0,1 ponto)
(D) Cerrado S. Senso (0,1 ponto)
(E)
E1- Cerrado típico. (0,1 ponto)
E2- Lobeira, pequi, barbatimão, caliandra, canela de ema, barbatimão, cajuzeiro do cerrado (0,2 ponto)
(F) Campo limpo e campo sujo. As razões por serem mais propícias a agricultura são o relevo plano (o que possibilita o cultivo e plantio com uso de poucas máquinas), ausência ou escassez de rochas (o que diminui o custo de manutenção deste mesmo maquinário), poucas plantas arbustivas e/ou arbóreas (o que diminui o custo para retirada da capa vegetal original), maior concentração de nitrogênio em virtude da presença de simbiose de plantas e microorganismos em raízes (ex: rizobium e micorrizas). (0,3 ponto)



Questão 02- (1,0 ponto)


· Raízes profundas
· Raízes que guardam reservas (tuberosas)
· Casca grossa
· Sementes que são ativadas ou quebram a dormência com a presença do fogo
· Rápido desenvolvimento de gemas (principalmente as gemas laterais)
· Folhas coriáceas




Questão 03- (1,0 ponto)


· A retirada abrupta da capa vegetal leva ao processo de lixiviação e erosão de solo e terrenos do cerrado.
· O processo de erosão leva ao acelerado assoreamento dos rios que, em geral, no cerrado, já têm um baixo volume de água (riachos e córregos)
· O uso de adubos químicos e processos para equilibrar e aumentar a produtividade no solo do cerrado associado a lixiviação, levam a um processo de eutrofização de águas superficiais.
· A destruição de habitat leva a rápida diminuição e até mesmo extinção de espécies o que diminui a biodiversidade do cerrado.
· A retirada da capa vegetal diminui o suprimento e auto sustentação da matéria orgânica no solo o que acarreta um rápido esgotamento de produtividade com a agricultura.
· O uso de máquinas pesadas na agricultura e a pecuária extensiva levam a um processo de compactação de solos, diminuindo a permeabilidade de águas e conseqüentemente afetando negativamente as reservas subterrâneas de água.
· As diminuições de reservas de água aumentam a problemática da seca elevando o nível de incêndios, doenças respiratórias e qualidade de vida nas cidades.
· Os incêndios criminosos que agilizam a retirada da capa vegetal original levam a labaredas de fogo de alta temperatura que danificam definitivamente a vegetação e eliminam sementes que potencialmente poderiam renovar o cerrado.



Questão 04-


O solo é ácido em virtude da presença de altas concentrações de metais como ferro e alumínio. (0,6 ponto)
O processo de neutralização desta acidez para a agricultura se dá através da calagem, ou seja, a distribuição de cal (CaO) ou calcário (CaCO3) no solo. (0,4 ponto)


Questão 05-


(A) 1 (0,4 ponto)
(B) (0,4 ponto)
· Mutualismo simbiótico (bactérias nos nódulos de raiz da planta),
· Herbivoria(a vaca come a planta),
· Competição (entre as bactérias no solo ou entre as cianofícias),
· Saprofitismo (processo de decomposição).

(C) NH3 (Amônia) (0,2 ponto)




Questão 06-


(a) Produtividade primária líquida = 4,95 x 106 cal (x 10%) =
=Prod. Secundária brutra = 4,95 x 105 cal (x 10%) =
=Prod. Secundária líquida = 4,95 x 104 cal
Portanto o que estava disponível aos consumidores secundários é a matéria fixada nos consumidores primários, o que corresponde a 4,95 x 104 cal. (0,4 ponto)

(b) Produtores (02 ponto)
(c) Bactérias e Fungos.(0,2ponto) Decompositores (0,2 ponto)



Questão 07-


(a) Comensalismo (0,1 ponto)
(b) Inquilinismo (0,1 ponto)
(c) Simbiose ou mutualismo simbiótico (0,1 ponto)
(d) Protocooperação ou mutualismo cooperante (0,1 ponto)
(e) Amensalismo ou antibiose (0,1 ponto)
(f) Herbivoria e competição interespecífica (0,2 ponto)
(g) 3 (0,1 ponto)
(h) Amensalismo (antibiolse), herbivoria e competição interespecífica (0,2 ponto)



Questão 08-


(a) Sucessão ecológica primária (02 ponto)
(b) (0,3 ponto)
Climax – A
Ecese – C
Sere - B
(c) C=>B=>A (0,3ponto)
(d) Temperatura, ventos, água, oxigênio (0,2 ponto)



Questão 09


(A) (0,4 ponto)
· Alastramento de doenças,
· Contaminação química da água,
· Degradação de solos (impossibilitando até mesmo a agricultura),
· Atração e reprodução de pestes urbanas (insetos, ratos, pombos, etc.)

(B) (0,6 ponto)
· Contaminação de solos impossibilitando por longos períodos a sucessão ecológica secundária.
· Contaminação de águas levando a eutrofização
· Eliminação de habitat naturais e extinção de espécies nativas
· Introdução de espécies invasoras e que levam a um desequilíbrio ecológico por competição, predatismo ou parasitismo.




Questão 10-


(A) (0,6 ponto)
(B) Algum fator externo foi abruptamente introduzida no ambiente como novos predadores, alguma doença, competidores ou mesmo a caça sem controle; o que levou os herbívoros a extinção. Tal fato se justifica já que a quantidade de plantas aumentou e a de carnívoros diminuiu; fatores intrínsecos que levariam a um aumento da população de herbívoros e não sua extinção. (0,2 ponto)
(C) Tal fato ocorre pela ausência de herbívoros. (0,2 ponto)

quarta-feira, 3 de outubro de 2007

Texto - Anatomia e fisiologia do sistema sensorial (8 ano - Ensino Fundametal)

Órgãos Sensoriais

1. Introdução


Os animais contam com uma série de "janelas" abertas para o meio, ou seja, estruturas que colocam o sistema nervoso em contato com os estímulos provenientes do ambiente: cheiro, imagens, sons, etc. Essas estruturas são os chamados órgãos sensoriais.
As informações referentes ao ambiente são percebidas pelos órgãos dos sentidos e continuamente enviadas ao encéfalo, na forma de impulsos nervosos. Portanto, pode-se dizer que os órgãos sensoriais são transdutores, pois convertem uma forma de energia (som, luz, calor, etc.) em outra (impulso nervoso).
A porção inicial dos nossos equipamentos sensoriais é constituída pelos receptores, cuja função é converter diferentes formas de estímulos ambientais em um potencial gerador, em suas menbranas. Esses receptores conectam-se com fibras nervosas, cujos neurônios transformam esse potencial gerador em um potencial de ação, transmitindo-o para o encéfalo na forma de um impulso nervoso.
Podemos classificar os receptores sensoriais, de acordo com a natureza do estímulo que o excita, em:
· receptores de superfície;
· fotorreceptores;
· receptores químicos;
· fonorreceptores; e
· receptores posturais.

2. Receptores de Superfície


Também são chamados receptores sensoriais cutâneos, localizados na pele. Os receptores de Krause são receptores de frio; os receptores de Ruffini são receptores de calor. As informações recolhidas por ambos, juntamente com as informações sobre a própria temperatura do corpo, desencadeiam mecanismos que garantem a homeotermia.
Há dois tipos de receptores mecânicos, na pele: os receptores de Meissner são sensíveis ao tato superficial, e discriminam as sensações de textura; os receptores de Vater-Pacini são sensíveis à pressão.
Existem ainda, na pele, as terminações nervosas livres, sensíveis à dor. Apesar do evidente desconforto gerado pela dor, ela deve ser encarada como um poderoso instrumento adaptativo. Afinal, se há dor é porque deve haver lesão, o que obriga os animais a se cuidarem, poupando a estrutura dolorosa. Trata-se, portanto, de um "sinal de alerta".

3. Fotorreceptores


Fotorreceptores são encontrados mesmo em protozoários. Neles, certas áreas, chamadas manchas ocelares, são sensíveis à luz. Alguns protozoários têm fototropismo positivo (deslocam-se em direção à luz); enquanto que outros têm fototropismo negativo (afastam-se da fonte de luz).
Nos metazoários, as estruturas fotossensíveis que não formam imagens mas permitem detectar a presença de luz são chamadas ocelos, encontrados em platelmintos, anelídeos e em algumas classes de moluscos, como gastrópodes e bivalvos.
Os fotorreceptores que formam imagens são, genericamente, chamados de olhos. Basicamente, encontram-se dois tipos de olhos: os olhos compostos, como os dos insetos, e os olhos de câmaras, como os dos vertebrados.
O olho composto, dos insetos, é formado por unidades chamadas omatídeos. A imagem que o olho composto oferece é chamada "imagem em mosaico", formada por milhares de pequenas imagens.
Os olhos mais desenvolvidos e que oferecem melhor qualidade de imagem são os olhos de câmara, encontrados nos moluscos cefalópodos e nos vertebrados. Esse tipo de olho guarda muitas semelhanças com uma máquina fotográfica.
Como em uma câmara fotográfica, a imagem que se projeta sobre a retina é invertida. O cérebro encarrega-se de invertê-la, oferecendo-nos a visão correta das coisas.
O globo ocular é revestido por uma camada de tecido fibroso chamado esclera. Externamente a ela, está uma membrana bem mais delgada e transparente, conjuntiva. Na porção mais anterior do globo, a esclera tem uma parte transparente, a córnea. Trata-se da mais poderosa lente convergente do olho. O espaço interno do globo ocular é ocupado pelos humores: humor aquoso (entre a córnea e o cristalino) e humor vítreo (do cristalino até a retina).
Após atravessar a córnea e o humor aquoso, o feixe de raios luminosos passa pelo cristalino, outra lente convergente. Embora seu poder de convergência não seja tão elevado quanto ao da córnea, ele tem uma propriedade peculiar: encontra-se ligado ao músculo ciliar, que pode aumentar ou diminuir sua curvatura. Dessa forma, permite a focalização correta de objetos colocados a diferentes distâncias. Essa capacidade de focalização chama-se acomodação visual, e diminui com o envelhecimento, pois o cristalino vai gradativamente perdendo sua elasticidade.
A quantidade de luz que alcança o interior do globo ocular depende do diâmetro da pupila, o orifício da íris (parte colorida dos olhos). Em locais escuros, a pupila encontra-se bastante aberta; em locais intensamente iluminados, fecha-se.
Depois de atravessar o cristalino e o humor vítreo, o feixe luminoso atinge a retina, membrana apoiada sobre a porção posterior da face interna da esclera, onde estão as células fotossensíveis.

As células fotossensíveis da retina transformam o estímulo luminoso em impulsos elétricos, transmitidos ao cérebro pelos nervos ópticos. Existem dois tipos de células receptoras: os cones e os bastonetes.
Os cones fornecem uma imagem mais rica em detalhes e com distinção de cores. Em contrapartida, seu limiar de excitação é elevado, ou seja, necessitam de grande intensidade luminosa para que sejam excitados. Os bastonetes, por sua vez, não oferecem imagem tão nítida nem reconhecem cores, mas sua sensibilidade à luz é maior que a dos cones, e permitem enxergar na penumbra. Em situações de baixa luminosidade a visão depende quase exclusivamente dos bastonetes.
As serpentes peçonhentas do grupo das solenóglifas, como a cascavel e a jararaca, possuem uma estrutura sensível à luz infravermelha. Trata-se da fosseta loreal, localizada entre o olho e a narina. Esse órgão é útil na localização de fontes de calor, que podem ser outros animais, na mata.
Graças à fosseta loreal, as serpentes só podem detectar animais homeotermos, pois apenas eles são mais quentes que o ambiente e dissipam calor. Diante de uma fonte intensa de emissão de infravermelho, as serpentes provavelmente irão fugir, pois estão diante de um animal de grande porte. Por isso, justifica-se o hábito de se manterem fogueiras acesas em acampamentos, pois afugentam as serpentes. Fontes de emissão de pequena intensidade são interpretadas, pela serpente, como animais de pequeno porte e, portanto, passíveis de serem atacados.

4.Receptores Químicos


Há dois tipos de receptores químicos: os que se excitam no contato com substâncias solúveis em água são os receptores do paladar ,enquanto aqueles que percebem substâncias voláteis são os receptores olfativos. Apesar da semelhança quanto à natureza da excitação, os receptores olfativos têm uma nítida vantagem: não necessitam do contato direto com a fonte do estímulo, e permitem a tomada de decisões com antecipação, em relção aos receptores do paladar.
Os receptores do paladar encontram-se nas papilas gustativas, que se distribuem na superfície da língua. Há 4 sensações gustativas básicas: doce, salgado, azedo e amargo. De suas combinações em diferentes proporções, resultam todos os sabores que podemos perceber.
O olfato permite a percepção de substâncias dissolvidas no ar (para os animais terrestres) ou na água (para os aquáticos). Nos mamíferos, a área olfativa está localizada no teto da cavidade nasal; nos seres humanos, é relativamente pequena, se comparada com a de outros animais.
O olfato tem papel adaptativo importante: os cães delimitam seus territórios com a própria urina, um verdadeiro "aviso químico" para os eventuais intrusos. Ao saírem de casa, os cães farejam o ar e o solo antes mesmo de olharem para os lados. Pelo olfato, os animais reconhecem a aproximação de presas ou de predadores. Muito deles, inclusive, desenvolvem interessantes estratégias de caça, aproximando-se da vítima sempre contra o vento, evitando que sua aproximação seja pressentida antes de ter distância suficientemente pequena para desferir o golpe final.
O olfato é usado, ainda, na busca de parceiros sexuais. Os machos de muitas espécies são capazes de reconhecer, pelo olfato, as fêmeas que estão no período do cio, quando elas estão férteis e propensas à cópula.
O bulbo olfativo é a região do cérebro que recebe as informações sensoriais provenientes da mucosa olfativa. Nos seres humanos, é uma estrutura pequena, o que se relaciona com nossa pouca acuidade olfativa, comparada com a de outros animais.

5. Fonorreceptores

A emissão de sons está associada a vibrações do meio (ar, sólidos ou água ). Em muitos animais, existem receptores capazes de detectar essas vibrações e convertê-las em percepção auditiva (ou sonora ). São os chamados fonorreceptores.
Curiosamente, nos mais diversos grupos animais os sistemas de fonorrecepção são bastante semelhantes : contêm células ciliadas, mergulhadas em líquidos. As vibrações sonoras transmitem-se a esses líquidos e movimentam os cílios das células que, estimuladas, desencadeiam um potencial gerador e, a partir dele, inicia um impulso nervoso. Nos peixes, essas células ciliadas estão localizadas no chamado sistema da linha lateral; nos vertebrados terrestres, estão no ouvido.
O sistema da linha lateral consiste em um sistema de canais que se comunicam com a superfície corporal por meio de pequenos orifícios alinhados ao longo da superfície lateral do corpo. As vibrações da água são detectadas por esse sistema, que permite ao animal perceber a aproximação de animais ou de outros objetos, e até mesmo pequenas variações na pressão da água.
Nos vertebrados terrestres, o sistema de células ciliadas encontra-se no interior de uma câmara cheia de líquido, o ouvido interno. Passaremos a descrever a audição em mamíferos, tomando como modelo o equipamento auditivo humano.

O ouvido humano é dividido em três partes:

• ouvido externo: formado pelo pavilhão auditivo e pelo conduto auditivo;
• ouvido médio: cavidade do osso temporal, que possui duas membranas - o tímpano, que se comunica com o exterior; e a janela oval, que se comunica com o ouvido interno. Abre-se no ouvido médio, ainda, a trompa de Eustáquio, que comunica essa cavidade com a nasofaringe;
• ouvido interno: consiste em um complexo sistema de canais cheios de líquido - a perilinfa - que banha células ciliadas. Inclui a cóclea e os canais semi-circulares.
O som faz vibrar o tímpano, cuja vibração é transmitida à janela oval por um sistema de alavancas formado por três ossículos da cadeia ossicular: o martelo, a bigorna e o estribo. A movimentação da janela oval faz oscilar a perilinfa, e essa oscilação é percebida pelas células ciliadas que revestem internamente a cóclea, gerando um potencial de ação propagado ao cérebro pelo nervo acústico (ou nervo auditivo ).
Para que a membrana timpânica possa vibrar livremente, as pressões nas faces interna e externa devem ser iguais. Através da trompa de Eustáquio, o ar pode penetrar da faringe até o ouvido médio, mantendo a pressão interna igual à pressão externa (pressão atmosférica ). Situações que provocam distensão ou retração do tímpano diminuem a acuidade auditiva. É o que ocorre, por exemplo, quando estamos resfriados: a mucosa nasal inflamada obstrui a abertura da trompa de Eustáquio, impedindo a entrada de ar no ouvido médio. Dessa forma, as pressões nas faces interna e externa do tímpano tornam-se diferentes; o tímpano retraído, passa a não vibrar normalmente, e a capacidade auditiva diminui. Sentimo-nos parcialmente "surdos"nessa situação.
Outra circunstância em que essa alteração pode ser notada é quando descemos uma montanha. O aumento repentino da pressão atmosférica "empurra"o tímpano para dentro, e ele deixa de vibrar livremente. O ato de abrir a boca e engolir abre o orifício da trompa, na faringe, e permite a entrada de ar no ouvido médio, igualando as pressões nas duas faces do tímpano. Essas manobras nos permitem recobrar a plena capacidade auditiva.

6. Receptores Posturais



A presença de receptores posturais é importante para os animais, pois determina sua posição em relação ao ambiente, um dos componentes da chamada orientação espacial. Essa orientação ocorre graças à atração gravitacional.
Os órgãos de percepção postural dos invertebrados são os estatocistos.
Nos vertebrados, a percepção postural é mantida pelos três canais semicirculares do ouvido interno, cujo conjunto é chamado labirinto. O interior dos canais contém líquido e, em suas extremidades dilatadas, estão pequenos grânulos de carbonato de cálcio. A cada mudança postural, o deslocamento dos grânulos e da perilinfa excita as células receptoras, que enviam impulsos nervosos ao encéfalo.